Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | ||
|---|---|---|---|---|---|---|
| Plasmid | 51763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | Add to Cart | |
This material is available to academics and nonprofits only.
Backbone
- Vector backbonelentiCRISPR (pXPR_001), Addgene plasmid #49535(Search Vector Database)
- Backbone manufacturerZhang lab
- Vector typeMammalian Expression, Lentiviral, CRISPR
- Selectable markersPuromycin
Growth in Bacteria
- Bacterial Resistance(s)Ampicillin
- Growth Temperature37°C
- Growth Strain(s)Stbl3
- Growth instructionsUse SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
- Copy numberHigh Copy
Gene/Insert1
- Gene/Insert nameCas9
- Alt nameS. pyogenes CRISPR-Cas9
- SpeciesSynthetic
- Insert Size (bp)4200
- PromoterEFS
Cloning Informationfor Gene/Insert 1
- Cloning methodRestriction Enzyme
- 5′ cloning siteBamHI(not destroyed)
- 3′ cloning siteNheI(not destroyed)
- 5′ sequencing primerGGTACAGTGCAGGGGAAAGA
- 3′ sequencing primerTGCCCTCCAAATATGTGAACT (Common Sequencing Primers)
Gene/Insert2
- Gene/Insert namePuromycin resistance
- Alt namepuromycin N-acetyl-transferase
- Alt namePAC
- Insert Size (bp)600
- PromoterEFS
Cloning Informationfor Gene/Insert 2
- Cloning methodRestriction Enzyme
- 5′ cloning siteNheI(not destroyed)
- 3′ cloning siteMluI(not destroyed)
- 5′ sequencing primerTGCTGCTACTAAGAAAGCTGGTC (Common Sequencing Primers)
Gene/Insert3
- Gene/Insert nameEGFP sgRNA 4
- Alt nameEGFP targeting RNA element #4 (with +85 chimeric RNA)
- SpeciesSynthetic
- Insert Size (bp)96
- PromoterU6
Cloning Informationfor Gene/Insert 3
- Cloning methodRestriction Enzyme
- 5′ cloning siteBsmBI(destroyed during cloning)
- 3′ cloning siteBsmBI(destroyed during cloning)
- 5′ sequencing primer#140 hU6-F (Common Sequencing Primers)
Resource Information
- Terms and Licenses
- UBMTA
- Industry Terms
- Not Available to Industry
- Articles Citing this Plasmid
- 2 References
Depositor Comments
gRNA target sequence GGAGCGCACCATCTTCTTCA
These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check images/Addgene/ for the most up-to-date information.


