Ordering

This material is available to academics and nonprofits only.

Backbone

• Vector backbone
  ColE (from pZ system) + AmpR
  (Search Vector Database)
• Backbone sizew/o insert(bp)2000
• Total vector size (bp)5300
• Vector type
  Synthetic Biology ; E. coli

Growth in Bacteria

• Bacterial Resistance(s)
  Ampicillin
• Growth Temperature
  37°C
• Growth Strain(s)
  XL1 Blue
• Copy number
  High Copy

Gene/Insert1

• Gene/Insert name
  ptet_ompC_gfpAaV
• Species
  E. coli
• Insert Size (bp)
  1800
• Mutation
  AaV degradation tag added to the 3'end
• Promoterptet
• Tag/ Fusion Protein
  • gfp (C terminal on insert)

Cloning Informationfor Gene/Insert 1

• Cloning methodRestriction Enzyme
• 5′ cloning siteAatII(destroyed during cloning)
• 3′ cloning siteBamH1(not destroyed)
• 5′ sequencing primerctcatgagcggatacat atttgaa
• 3′ sequencing primercgcggatcc TGAGCGGATACATATTTGAATGTA
(Common Sequencing Primers)

Gene/Insert2

• Gene/Insert name
  pLac_st3 TetR_mCherry
• Insert Size (bp)
  1800
• PromoterpLac
• Tag/ Fusion Protein
  • mCherry (C terminal on insert)

Cloning Informationfor Gene/Insert 2

• Cloning methodRestriction Enzyme
• 5′ cloning siteBamH1(not destroyed)
• 3′ cloning siteApa1(not destroyed)
• 5′ sequencing primerGCTGGGATTA CACATGGCAT GGAT
• 3′ sequencing primeragctgatacc gctcgccgca gccgaacg
(Common Sequencing Primers)

Resource Information

• A portion of this plasmid was derived from a plasmid made by
  gfp is from pTak 102 with a modified degradation tag added to gfpmCherry is from Tsein LabTetR is from pjm31
• Terms and Licenses
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms
  • Not Available to Industry