Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 37759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | Add to Cart |
This material is available to academics and nonprofits only.
Backbone
- Vector backboneColE (from pZ system) + AmpR(Search Vector Database)
- Backbone sizew/o insert(bp)2000
- Total vector size (bp)4800
- Vector typeSynthetic Biology ; E. coli
Growth in Bacteria
- Bacterial Resistance(s)Ampicillin
- Growth Temperature37°C
- Growth Strain(s)XL1 Blue
- Copy numberHigh Copy
Gene/Insert1
- Gene/Insert nameptet_ompC_gfpAaV
- SpeciesE. coli
- Insert Size (bp)1800
- MutationAaV degradation tag added to the 3'end
- Promoterptet
- Tag/ Fusion Protein
- gfp (C terminal on insert)
Cloning Informationfor Gene/Insert 1
- Cloning methodRestriction Enzyme
- 5′ cloning siteAatII(not destroyed)
- 3′ cloning siteBamH1(not destroyed)
- 5′ sequencing primerctcatgagcggatacat atttgaa
- 3′ sequencing primercgcggatcc TGAGCGGATACATATTTGAATGTA (Common Sequencing Primers)
Gene/Insert2
- Gene/Insert namepLac_micC_mCherry
- Insert Size (bp)1000
- PromoterpLac
- Tag/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Informationfor Gene/Insert 2
- Cloning methodRestriction Enzyme
- 5′ cloning siteBamH1(not destroyed)
- 3′ cloning siteApa1(not destroyed)
- 5′ sequencing primerGCTGGGATTA CACATGGCAT GGAT
- 3′ sequencing primeragctgatacc gctcgccgca gccgaacg (Common Sequencing Primers)
Resource Information
- A portion of this plasmid was derived from a plasmid made bygfp is from pTak 102 with a modified degradation tag added to gfpmCherry is from Tsein Lab
- Terms and Licenses
- UBMTA
- Ancillary Agreement for Plasmids Containing FP Materials
- Takara Bio Limited Use Label License (formerly Clontech)
- Industry Terms
- Not Available to Industry