

Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 121539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | Add to Cart | |
AAV5 | 121539-AAV5 | Virus (100 µL at titer ≥ 7×10¹² vg/mL)and Plasmid.More Information | $380 | Add to Cart |
This material is available to academics and nonprofits only.
Backbone
- Vector backbonepOTTC1479 - pAAV SYN1 iRFP-FLAG(Search Vector Database)
- Backbone manufacturerNIDA_GEVVC
- Backbone sizew/o insert(bp)4500
- Total vector size (bp)5571
- Vector typeMammalian Expression, AAV
Growth in Bacteria
- Bacterial Resistance(s)Ampicillin
- Growth Temperature30°C
- Growth Strain(s)NEB Stable
- Copy numberLow Copy
Gene/Insert
- Gene/Insert nameHA-tagged hM3D(Gq)
- SpeciesH. sapiens (human)
- Insert Size (bp)1800
- GenBank ID1131CHRM3
- Entrez GeneCHRM3(a.k.a. EGBRS, HM3, PBS)
- PromoterSYN1
- Tag/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning methodLigation Independent Cloning
- 5′ sequencing primerhSYN1 F417 ACTCAGCGCTGCCTCAGTCT
- 3′ sequencing primerWPRE R1ATGAAAGCCATACGGGAAGC (Common Sequencing Primers)
Resource Information
- Supplemental Documents
- pOTTC1596 - pAAV SYN1 HA-hM3D(Gq).ape.ape
- A portion of this plasmid was derived from a plasmid made byInsert was amplified from pOTTC1328, Addgene 89149
- Terms and Licenses
- UBMTA
- Industry Terms
- Not Available to Industry
Information for AAV5 (Catalog # 121539-AAV5)(Back to top)
Purpose
Ready-to-use AAV5 particles produced from pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) (#121539). In addition to the viral particles, you will also receive purified pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) plasmid DNA.
Synapsin-driven, HA-tagged hM3D(Gq) for neuronal activation. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume100 µL
- Titer≥ 7×10¹² vg/mL
- Pricing$350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- StorageStore at -80℃. Thaw just before use and keep on ice.
- ShipmentViral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmidsencode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
- BufferPBS + 0.001% Pluronic F-68 + 200 mM NaCl
- SerotypeAAV5
- PurificationIodixanol gradient ultracentrifugation
- Reporter GeneHA
Biosafety
Requestor is responsible for compliance withtheir institution"s biosafety regulations.Lentivirus is generally considered BSL-2. AAV isgenerally considered BSL-1, but may requireBSL-2 handling depending on the insert.Biosafety Guide
Resource Information
- Terms and Licenses
- Terms of Use for Viral Vectors
- Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). Thespecific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for moreinformation.