>>> 更多资讯详情请访问蚂蚁淘商城
品牌分类
品牌咨询
联系方式
公司地址
苏州工业园区生物纳米园A4#216
联系电话
4000-520-616 / 18915418616
传真号码
0512-67156496
电子邮箱
info@ebiomall.com
公司网址
https://www.ebiomall.com
(PDF) Combined Inhibition of DYRK1A, SMAD, and Trithorax...
(PDF) Combined Inhibition of DYRK1A, SMAD, and Trithorax Pathways Synergizes to Induce Robust Replication in Adult Human Beta Cells ArticleCombined Inhibition of DYRK1A, SMAD, andTrithorax Pathways Synergizes to Induce RobustReplication in Adult Human Beta CellsGraphical AbstractHighlightsdAdult human pancreatic beta cells can be induced toproliferate at high ratesdDriven by synergy between DYRK1A inhibitors and TGFbsuperfamily inhibitorsdReflects activation of cyclins and CDKs accompanied by CDKinhibitor suppressiondProliferation occurs in type 2 diabetic beta cells, withenhanced differentiationAuthorsPeng Wang, Esra Karakose,Hongtao Liu, ..., Donald K. Scott,Adolfo Garcia-Ocan˜a,Andrew F. StewartCorrespondenceandrew.stewart@mssm.eduIn BriefAdult human pancreatic beta cells arenotoriously resistant to replication. Wanget al. find that the combination of theDYRK1A inhibitor harmine with aninhibitor of the TGFbsuperfamily ofreceptors induces synergistic increasesin human beta cell cells in vitro and in vivoassociated with enhanced differentiation.Wang et al., 2019, Cell Metabolism 29, 638–652March 5, 2019 ª2018 Elsevier Inc.https://doi.org/10.1016/j.cmet.2018.12.005 Cell MetabolismArticleCombined Inhibition of DYRK1A, SMAD,and Trithorax Pathways Synergizes to InduceRobust Replication in Adult Human Beta CellsPeng Wang,1,5Esra Karakose,1,5Hongtao Liu,1Ethan Swartz,1Courtney Ackeifi,1Viktor Zlatanic,1Jessica Wilson,1Bryan J. Gonza´lez,3Aaron Bender,1Karen K. Takane,1Lillian Ye,4George Harb,4Felicia Pagliuca,4Dirk Homann,1Dieter Egli,3Carmen Argmann,2Donald K. Scott,1Adolfo Garcia-Ocan˜a,1and Andrew F. Stewart1,6,*1Diabetes, Obesity, and Metabolism Institute, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA2Department of Genetics and Genomic Sciences, Icahn Institute for Genomics and Multiscale Biology, Icahn School of Medicine at MountSinai, New York, NY 10029, USA3Naomi Berrie Diabetes Center, Columbia University, New York, NY 10032, USA4Semma Therapeutics, Cambridge, MA 02142, USA5These authors contributed equally6Lead Contact*Correspondence: andrew.stewart@mssm.eduhttps://doi.org/10.1016/j.cmet.2018.12.005SUMMARYSmall-molecule inhibitors of dual-specificity tyro-sine-regulated kinase 1A (DYRK1A) induce humanbeta cells to proliferate, generating a labeling indexof 1.5%–3%. Here, we demonstrate that combinedpharmacologic inhibition of DYRK1A and transform-ing growth factor beta superfamily (TGFbSF)/SMADsignaling generates remarkable further synergisticincreases in human beta cell proliferation (averagelabeling index, 5%–8%, and as high as 15%–18%),and increases in both mouse and human beta cellnumbers. This synergy reflects activation of cyclinsand cdks by DYRK1A inhibition, accompanied bysimultaneous reductions in key cell-cycle inhibitors(CDKN1C and CDKN1A). The latter results from inter-ference with the basal Trithorax- and SMAD-medi-ated transactivation of CDKN1C and CDKN1A.Notably, combined DYRK1A and TGFbinhibitionallows preservation of beta cell differentiated func-tion. These beneficial effects extend from normal hu-man beta cells and stem cell-derived human betacells to those from people with type 2 diabetes, andoccur both in vitro and in vivo.INTRODUCTIONInhibition of the enzyme dual-specificity tyrosine phosphoryla-tion-regulated kinase 1A (DYRK1A) in human beta cells, usingdrugs such as harmine, INDY, GNF4877, 5-iodotubericidin(5-IT), or CC-401, is able to induce proliferation (labeling indices)in the 1.5%–3% range, as assessed using Ki67, EdU, BrdU,and/or PCNA immunolabeling of insulin-containing cells derivedfrom human cadaveric islets (Aamodt et al., 2016; Abdolazimiet al., 2018; Dirice et al., 2016; Shen et al., 2015; Wang et al.,2015a, 2016). This notable accomplishment, confirmed in multi-ple laboratories, replicates the proliferation ‘‘rate’’ in human betacells in the first year of life, the only stage of human developmentat which appreciable beta cell proliferation occurs (Gregg et al.,2012; Kassem et al., 2000; Meier et al., 2008; Wang et al., 2015b).One can reasonably assume that more rapid beta cell prolifera-tion would be attractive in order to replete or restore beta cellmass to normal in people with type 1 and type 2 diabetes. Sincecomplete silencing of DYRK1A in human beta cells does notappreciably further increase proliferation (Dirice et al., 2016;Wang et al., 2015a), we surmised that combination treatmentwith other classes of potential beta cell mitogenic small mole-cules might enhance efficacy of harmine analogs. We selectedTGFbSF receptor inhibitors for combination therapy for severalreasons. First, in genomic and transcriptomic analyses of betacell mitogenic pathways in human insulinoma, SMAD signalingand chromatin remodeling pathways were the most statisticallysignificant (Wang et al., 2017). Second, as described below,we observed that TGFbSF members were abundant in isolatedhuman beta cells, and some were affected by pharmacologicDYRK1A inhibition. Third, Gittes et al.; Kim et al.; Bhushan,Kulkarni et al.; Schneyer et al.; Teramoto et al.,; and Anneset al. (Abdolazimi et al., 2018; Brown and Schneyer, 2010; Brownet al., 2014; Dhawan et al., 2016; El-Gohary et al., 2014; Mukher-jee et al., 2007; Nomura et al., 2014; Smart et al., 2006; Xiao et al.,2014, 2016; Zhou et al., 2013) have each reported that genetic orpharmacologic TGFbSF pathway inhibition in rodent beta cellscan lead to rodent beta cell proliferation.Transforming growth factor beta superfamily (TGFbSF)signaling is complex (Antebi et al., 2017; Brown and Schneyer,2010; Brown et al., 2014; Dhawan et al., 2016; El-Gohary et al.,2014; Gaarenstroom and Hill, 2014; Macias et al., 2015; Mukher-jee et al., 2007; Nomura et al., 2014; Smart et al., 2006; Stewartet al., 2015; Xiao et al., 2014, 2016; Zhou et al., 2013). In itssimplest form, it involves a series of ligands (e.g., TGFbs 1,2,3,activins, inhibins, glia-derived factors, and bone morphogenicproteins), a series of cognate receptors, and a repertoire ofendogenous inhibitors (e.g., sclerostin and follistatin-like factors)that signal downstream through a series of activating or receptorR-SMADs (SMADs 1,2,3,5,8/9) and the co-SMAD, SMAD4, and638 Cell Metabolism 29, 638–652, March 5, 2019 ª2018 Elsevier Inc. are blocked by one of two inhibitory I-SMADs (SMADs 6,7). Onceactivated, R-SMAD heteromers translocate to the nucleus,where they serve individually or in complexes to transactivateor repress target genes. Notably, at some of these loci, SMADsintegrate into epigenetic chromatin-modifying complexes, suchas the trithorax group complex (TrxG) that includes histonemethylases (e.g., MEN1) and histone demethlyases (e.g.,KDM6A) that regulate chromatin access (Antebi et al., 2017;Brown and Schneyer, 2010; Brown et al., 2014; Dhawan et al.,2016; El-Gohary et al., 2014; Gaarenstroom and Hill, 2014;Macias et al., 2015; Mukherjee et al., 2007; Nomura et al.,2014; Smart et al., 2006; Stewart et al., 2015; Xiao et al., 2014,2016; Zhou et al., 2013).In this report, we demonstrate that combined pharmacologicor genetic inhibition of DYRK1A and TGFbSF signaling inducesremarkable and previously unattainable rates of human betacell proliferation in vitro and in vivo, and actually increases hu-man and mouse beta cell numbers. We explore the underlyingmechanisms that drive this remarkable rate of proliferation andshow that the results apply not only to beta cells from normalcadaveric human islets, but also to human stem cell (hESC)-derived beta cells, and those from people with type 2 diabetes.RESULTSCombinations of DYRK1A Inhibitors and TGFbSFInhibitors Induce Synergistic Human Beta CellProliferation and Increase Beta Cell NumbersGene expression profiles from fluorescence-activated cell sort-ing (FACS)-sorted human beta cells (Wang et al., 2017) wereremarkable for the abundance of select members of the TGFbSF.In addition, harmine treatment of human islets resulted in notablechanges in TGFbSF members (Tables S1 and S2). Reasoningfrom these observations, from the prominence of SMADsignaling in human insulinoma cell proliferation (Wang et al.,2017), and from the beneficial effects of TGFbsignaling inhibitionin mouse islets described by Bhushan, Gittes, Kim, Schneyer,and Teramoto et al. (Brown and Schneyer, 2010; Brown et al.,2014; Dhawan et al., 2016; El-Gohary et al., 2014; Mukherjeeet al., 2007; Nomura et al., 2014; Smart et al., 2006; Xiao et al.,2014, 2016; Zhou et al., 2013), we explored the effects ofTGFbSF pharmacologic inhibitors on human beta cell prolifera-tion in a large number of human cadaveric islet preparations (Fig-ures 1A–1C). Vehicle alone (DMSO) had no effect, and harminedisplayed its usual 2% labeling index (Wang et al., 2015a), asassessed using Ki67 labeling of insulin-positive cells. A broadrange of TGFbreceptor, BMP receptor, and activin receptor in-hibitors had little effect on human beta cell proliferation, aspreviously reported (Dhawan et al., 2016). In contrast, everyTGFbSF receptor inhibitor tested, whether targeting TGFb, acti-vin, or BMP receptors, when used in combination with harmine,induced dramatic increases in the Ki67 labeling index in humanbeta cells. Proliferation rates (labeling indices) averaged in the5%–8% range; the large error bars reflect even higher prolifera-tion rates in occasional human islet preparations, sometimesachieving Ki67 labeling indices as high as 15%–18%. Theseresults were independently confirmed using automated, high-throughput, high-content imaging of human HUES8 hESC-derived beta cells (Figure S1)(Pagliuca et al., 2014).The beneficial effects were not confined to harmine, butextended to additional DYRK1A inhibitors, including INDY andleucettine-41 (Tahtouh et al., 2012)(Figures 1D and 1E). In addi-tion, in dose-response studies, the combinations fulfilled formalcriteria for pharmacologic synergy (Figures S2A and S2B).Further, the remarkable synergy could be observed with twoadditional measures of proliferation: BrdU incorporation andphospho-histone-H3 immunolabeling (Figures 1F, 1G, S2C,and S2D).Notably, the mitogenic effects of the combination were notspecific to beta cells: frequent proliferation was observed inalpha, delta, PP, ductal, and other non-beta cells within the isletas well (Figure 1B, red arrows; Figures S3A and S3B). No adverseeffects were observed with respect to beta cell death or DNAdamage, as assessed by TUNEL assay and gH2AX immunolab-eling, respectively (Figures S3C–S3E).We next examined whether harmine together with the TGFbinhibitor LY364947 could increase actual numbers of humanbeta cells, using two different approaches. First, using adulthuman cadaveric islets, we employed flow cytometry to countthe numbers of live human beta cells, previously labeled withan insulin promoter-driven adenovirus expressing the brightgreen fluorescent protein ZsGreen (Wang et al., 2017),following 4 days of exposure to vehicle or the harmine-LY364947 combination. As illustrated in Figure 1H, absolutebeta cell numbers increased in six of seven human islet prep-arations treated with the harmine-LY364947 combination, ascompared to the same human islets treated with vehicle. Sec-ond, to confirm these results independently, we used Mel1hESCs expressing GFP in one allele of the insulin locus (Mical-lef et al., 2012), differentiated into beta cells (Sui et al., 2018).Figure 1I illustrates the dramatic increase in absolute GFP+cell numbers in these hESC-derived cultures. Together, thesefindings demonstrate that the harmine-LY364947 combinationcan increase not only Markers of beta cell proliferation, butactual numbers of both stem cell-derived and adult humanbeta cells.Harmine-TGFbSF Inhibitor Combinations EnhanceMarkers of Human Beta Cell Differentiation in Normaland Type 2 Diabetes IsletsConcerned that activation of mitogenic pathways might leadto de-differentiation of beta cells, we explored gene expres-sion of a panel of markers of beta cell differentiation (Figures2A and 2B). As we had observed for harmine alone (Wanget al., 2015a), not only did the harmine-TGFbSF inhibitor com-bination fail to induce de-differentiation, but the oppositeoccurred: gene expression of key beta cell markers such asPDX1,NKX6.1,MAFA,MAFB,SLC2A2,andPCSK1 allincreased with combined harmine-TGFbSF inhibitor treat-ment,asassessedonwholeisletsbyqPCR;ISL1,SLC2A1,NEUROD,NKX2.2,andPCSK2 all remained the same as atbaseline. Only PAX4 declined, the significance of which isuncertain. These results were confirmed and expanded usingmassively parallel RNA sequencing (RNA-seq) of humancadaveric islets treated with the harmine-TGFbSF inhibitorcombination (Tables S1 and S2). Immunocytochemistry indispersed human islet preparations confirmed the increasesin PDX1, NKX6.1, and MAFA specifically in human beta cellsCell Metabolism 29, 638–652, March 5, 2019 639 (Figures 2CandS4A). Further, RNA-seq demonstrated thatso-called disallowed or forbidden beta cell genes (Pullenand Rutter, 2013; Schuit et al., 2012) were not altered bythe harmine-TGFbSF inhibitor combination (Table S2). In linewith the observations above, glucose-stimulated insulinsecretion was normal, and possibly accentuated, in human is-lets treated with the harmine-TGFbSF inhibitor combination(Figure 2D).Since de-differentiation of beta cells occurs in both mice andhumans with type 2 diabetes (Cinti et al., 2016; Talchai et al.,Figure 1. Induction of Human Beta Cell Proliferation and Augmentation of Beta Cell Numbers by Combined Harmine and TGFbSF InhibitorTreatment(A) The effects of harmine alone, and of various TGFbSF ligand inhibitors, some of which are specific for TGFbreceptors, and others for activin, inhibin, and BMPreceptors. As can be seen, and as reported previously (Aamodt et al., 2016; Abdolazimi et al., 2018; Dirice et al., 2016; Shen et al., 2015; Wang et al., 2015a, 2016),harmine induces Ki67 labeling in approximately 2% of normal human beta cells, and TGFbSF inhibitors lead to only margin al Ki67 labeling. However, each of theTGFbSF inhibitors in combination with harmine induces striking increases in Ki67 labeling in beta cells.(B) Examples of human islets, treated with the harmine-LY364947 combination, immunolabeled for insulin(green) and Ki67(red), exemplifying unprecedentedrates of proliferation. The white arrows illustrate beta cells labeled with Ki67; the red arrows indicate other non-beta cell types that are Ki67+. The panels on theright are enlarged from the white box within the main figure.(C) Examples of NKX6.1, insulin, and Ki67 and a merged view illustrating co-immunolabeling of Ki67 and NKX6.1 in insulin+cells.(D and E) The effects of two other harmine analogs , INDY (IN) (Wang et al., 2015a) (D) and leucettine-41 (Lu) (Tahtouh et al., 2012) (E), on human beta cell labelingwith Ki67 with or without addition of TGFbinhibitors LY and ALK5.(F and G) The effects of harmine and LY364947 alone or in combination on human islets using BrdU (overnight exposure) (F) and phospho-histone-3 (PHH3) (G).Examples of photomicrographs are provided in Figures S2C and S2D. Note that PHH3 captures only G2M phases of cell cycle, as compared to Ki67 and BrdU,which capture all phases of cell cycle, so that labeling indices for PHH3 are lower than for Ki67 and BrdU.(H) Effect of the harmine-LY combination on adult human beta cell numbers as assessed by FACS counting using an internal recovery standard,Spherotech beads.(I) Effects of the harmine-LY combination on numbers of Mel1-hESC-derived beta cells from four differe nt batches of cells. Each pair of dots connected by a linerepresents one batch of hESC-derived beta cells.In all panels, drug treatments were for 96 hr, and all experiments were done on dispersed islets. In (A) and (D)–(I), each black dot represents an individual humanislet preparation. Numbers of donors and beta cells counted are provided in Table S3. For all panels,+p 0.05 versus control by paired t test, andxp 0.05 byANOVA.++p 0.05 versus harmine treatment by paired t test, andxxp 0.05 versus harmine by ANOVA.640 Cell Metabolism 29, 638–652, March 5, 2019 2012), we next explored proliferation in islets derived from sixdonors with type 2 diabetes (Figure 2E). Remarkably, harminealone increased Ki67 immunolabeling to the same degreeobserved in non-diabetic islet donors (Wang et al., 2015a).Moreover, harmine in combination with three different TGFbSFinhibitors (LY364947, ALK5, and GW788388) led to synergisticincreases in Ki67 labeling, as had been observed in normalislets (Figures 1 and 2). Equally remarkably, harmine in combi-nation with the TGFbSF inhibitor ALK5 also led to significantincreases in expression of PDX1,NKX6.1, and MAFA inhuman type 2 diabetes islets (Figure 2F), results that extendto the combination of harmine plus GW788388 or LY364947(Figure S4B).Combined Harmine-TGFbSF Inhibition EfficacyRequires SMAD and DYRK1A SignalingTGFbSF ligands affect SMAD signaling but may also recruitother signaling pathways (Antebi et al., 2017; Brown andSchneyer, 2010; Stewart et al., 2015). To ascertain whetherthe harmine-TGFbSF inhibitor combination affected SMADsignaling, human islets were incubated with harmine aloneor in combination with two TGFbSF inhibitors, LY364947 orABCDEFFigure 2. The Harmine-TGFbSF Inhibition Combination Increases Beta Cell Differentiation Markers in Normal and Type 2 Diabetes Beta Cells(A and B) Effects of harmine and the harmine-LY364947 combination treatment for 4 days on key beta cell transcription factors (A) and markers of beta celldifferentiation (B) in whole human islets assessed by qPCR. The panels include five human islet preparations. *p 0.05 versus vehicle (DMSO) treatment.(C) Immunocytochemistry on dispersed human beta cells (green) showing that combination treatment increases PDX1, NKX6.1, and MAFA (red) specifically inbeta cells. Representative of experiments in three different human islet donor preparations. Brighter images are shown in Figure S4A.(D) Insulin secretion in response to low and high glucose in islets from eight different donors in the presence of vehicle, harmine, LY364947, or the harmine-LY364947 combination. *p 0.05 for high glucose versus low glucose.(E) Effects of harmine and TGFbinhibitors on beta cell Ki67 immunolabeling in islets from six donors with type 2 diabetes. *p 0.05 versus control. **p 0.05versus harmine.(F) Effects of harmine alone and with ALK5 on key beta cell transcriptio n factors and markers in whole islets from six donors with type 2 diabetes, as assessed byqPCR. Effects of additional TGFbinhibitors on type 2 diabetes islets are shown in Figure S4B. *p 0.05 versus control.All drug treatments were for 96 hr, and all experiments were performed on dispersed islets, except for (D), which employed whole islets. Error bars in all panelsindicate mean ± SEM. Numbers of donors and beta cells counted are provided in Table S3.Cell Metabolism 29, 638–652, March 5, 2019 641 ALK5, and the expression levels of various SMADs were as-sessed (Figure 3A). The harmine-TGFbSF inhibitor combina-tions led to reductions in SMAD3 phosphorylation withoutaltering SMAD2/3 abundance, and also led to dramatic reduc-tions in total SMADs 1/5/9 (note that antisera do not distinguishbetween these three SMADs). Perhaps most interestingly,harmine alone led to reductions in phospho-SMAD3 as wellas to reductions in total SMAD1/5/9, a result that extends theapparent reduced expression of select TGFbSF membersnoted earlier in Table S2.To explore the requirement for SMAD signaling in the prolifer-ation induced by the harmine-TGFbSF inhibitor combinations,we used adenoviruses expressing short hairpin RNAs (shRNAs)directed against the R-SMADs 2 and 3 and their co-SMAD,SMAD4, in human islets treated with harmine (Figure 3B). Weobserved that silencing these three R-SMADs further enhancedABCDEFGFigure 3. Requirements for DYRK1A and SMAD Signaling(A) Immunoblots of control, harmine-, LY364947-, ALK5 inhibitor-, or combination-treated whole human islets. While SMAD2 and SMAD3 (detected by the sameantibody) did not change, p-SMAD3 was reduced by harmine, and further reduced by LY364947 or ALK5 inhibitor and the combinations. SMAD1, 5, and 9 arealso detected by a common antibody, and are reduced by harmine and the drug combinations. The immunoblots are representative of separate experiments inhuman islets from three different donors.(B) Effects of a control adenovirus expressing an shRNA directed against LacZ and adenoviruses silencing SMAD2, 3, and 4 (150 MOI each) on Ki67immunolabeling in harmine-treated human islets.(C) Effects of adenoviral SMAD6 and SMAD7 overexpression (100 MOI each) on beta cell proliferation, alone and in combination with harmine.(D) An example of the mitogenic effects of SMAD7 silencing in human beta cells (green) on Ki67 immunolabeling.(E) The effects of adenoviral silencing of DYRK1A in combination with TGFbSF inhibitors GW788388 or LY364947. Ad.shLacZ indicates a control sh-adenovirusfor the Ad.shDYRK1A.(F) Effect of adenoviral DYRK1A overexpression or a control adenovirus expressing Cre (Ad.Cre) on proliferation in human islets treated with the harmine-LY364947 combination.(G) Examples of Ad.Cre- and Ad.DYRK1A-overexpressing viruses on Ki67 immunolabeling in human islets treated with harmine and LY364947. All adenovirusexperiments were for 96 hr, and all experiments were done on dispersed islets.In all panels, error bars represent mean ± SEM, *p 0.05 versus control, and **p 0.05 versus harmine. Numbers of donors and beta cells counted are provided inTable S3.642 Cell Metabolism 29, 638–652, March 5, 2019 harmine-induced human beta cell proliferation. Conversely,overexpressing the I-SMADs 6 and 7 by themselves had no ef-fect on proliferation, but markedly enhanced harmine-inducedproliferation (Figures 3C and 3D). Collectively, these resultsreveal three key insights. First, the proliferation generated bythe TGFbSF inhibitors when given in combination with harmineis mediated in large part or entirely via SMAD signaling, sincesilencing R-SMADs or overexpressing I-SMADs was able to sub-stitute for TGFbSF inhibitors in the combination. Second, har-mine itself has previously unrecognized inhibitory effects onSMAD signaling at the protein level (SMADs1/5/9 and phos-pho-SMAD3). And third, multiple SMAD families (i.e., both thecanonical TGFbreceptor-associated SMADs 2,3,4 and thecanonical BMP receptor-associated SMADs 1,5,8/9) participatein harmine-mediated proliferation.Harmine analogs derive their mitogenic effects in large part, ifnot exclusively, via inhibition of DYRK1A (Abdolazimi et al., 2018;Dirice et al., 2016; Shen et al., 2015; Wang et al., 2015a). Toexplore the presumed requirement for DYRK1A in the synergisticproliferation derived from the harmine-TGFbinhibitor combina-tion, we employed adenoviral silencing and overexpression ofDYRK1A, alone or in combination with TGFbSF inhibition (Fig-ures 3E–3G). These experiments reveal that DYRK1A silencingor loss markedly accentuates proliferation induced by theTGFbinhibitors GW788388 and LY364947, and conversely thatDYRK1A overexpression is able to block proliferative effectsof the harmine-TGFbinhibitor combination. Collectively, thestudies in Figure 3 illustrate that the majority, if not all, of the syn-ergistic effects of the harmine-TGFbinhibitor combination onhuman beta cell proliferation are attributable to combined inter-ruption of both DYRK1A and SMAD signaling. They further revealthat harmine can have unanticipated direct or indirect effects onSMADs to reduce TGFbSF signaling.The Harmine-TGFbSF Inhibitor Synergy ReflectsComplementary Effects on Cyclins/CDKs and CDKInhibitorsReasoning that harmine and harmine-TGFbSF inhibitors (andDYRK1A and SMADs, respectively) must ultimately orchestratecell-cycle entry via cell-cycle activators and cell-cycle inhibitors,we examined gene expression of cell-cycle activators and inhib-itors in whole islets treated with vehicle, harmine, TGFbinhibitor,or the harmine-TGFbinhibitor combination (Figures 4A and 4B).Harmine alone, as described previously (Wang et al., 2015a),induced expression of a number of cell-cycle activators (e.g.,CDK1,CCNA1,CCNE2, and CDC25A). In contrast, TGFbinhibi-tion alone had little effect on cell-cycle activators. Notably, theharmine-TGFbinhibitor combination induced no further activa-tion of these or other cyclins or cdks: the harmine-TGFbinhibitorcombination was similar to harmine alone. These results wereindependently confirmed and extended by RNA-seq of humanislets (Tables S1 and S2).Cell-cycle inhibitors behaved differently (Figure 4B). Harminealone had modest and limited effects on cell-cycle inhibitorexpression, with the exception of CDKN1C (encoding p57KIP2),which declined by 50% as described previously (Wang et al.,2015a). In contrast, TGFbinhibition alone, or in combinationwith harmine, reduced expression of CDKN2B (encodingp15INK4b), CDKN1A (encoding p21CIP), and CDKN1C/p57KIP2.There was also a small but significant reduction in CDKN2A (en-coding p16INK4a). There was no change in the expression ofCDKN1B (encoding p27CIP), an important inhibitor of cell-cycleprogression in the mouse beta cell. These results also were inde-pendently confirmed and extended by RNA-seq of human islets(Tables S1 and S2).To explore the mechanism underlying the decline in CDKN1A,CDKN1C, and CDKN2B in response to TGFbinhibition, we usedadenoviruses to silence R-SMADs 2, 3, and 4, or to overexpressI-SMADs 6 and 7 in human islets, and queried effects onCDKN1A,CDKN1C, and CDKN2B expression. Silencing theR-SMADs or overexpressing I-SMADs reduced CDKN1A andCDKN1C (Figures 4C and 4D), and had a small but non-signifi-cant effect on CDKN2B (Figure S5A). To determine whetherCDKN1A and/or CDKN1C reductions might underlie the syner-gistic effects of the TGFbSF inhibition in the harmine-TGFbSFinhibitor combination, we silenced CDKN1A and CDKN1C inhuman islets, either alone or in combination with harmine treat-ment (Figure 4E). As reported previously (Avrahami et al., 2014;Wang et al., 2017), CDKN1C silencing led to a modest increasein human beta cell proliferation, whereas silencing CDKN1A hadno effect. In contrast, in the presence of harmine, silencing ofeither or both CDKN1A and CDKN1C led to robust human betacell proliferation. Finally, to confirm whether or not CDKN1A,CDKN1C, and CDKN2B truly function as cell-cycle inhibitors inhuman beta cells, we overexpressed them in human isletstreated with harmine and the TGFbinhibitor LY364947. Overex-pression of each cell-cycle inhibitor dramatically reduced prolif-eration in harmine-TGFbinhibitor-treated human beta cells torates approaching zero (Figure 4F).Collectively, these observations suggest a mechanism for thesynergistic effects of the harmine-TGFbinhibitor combination onproliferation: harmine, through DYRK1A inhibition and nuclearNFAT retention (Demozay et al., 2011; Goodyer et al., 2012;Heit et al., 2006; Wang et al., 2015a), and likely other mecha-nisms discussed below, predominantly activates cell-cyclegenes; in a complementary fashion, TGFbinhibition, via attenu-ation of SMAD signaling, reduces expression of CDKN2B,CDKN1A, and CDKN1C, each of which normally functions as acell-cycle inhibitor in human beta cells. This TGFbinhibitor-mediated reduction in CDKN2B,CDKN1A, and CDKN1C syner-gizes with the harmine-induced, DYRK1A-mediated increases incyclins and CDKs, permitting greater cell-cycle activation thanoccurs via either harmine treatment or TGFbinhibition alone.Effects of R-SMADs and Trithorax Complex on Cell-Cycle InhibitorsR-SMADs may transactivate or repress genes, and may do so incomplexes that include Trithorax members (Antebi et al., 2017;Brown and Schneyer, 2010; Brown et al., 2014; Chandrasekhar-appa et al., 1997; Chen et al., 2009, 2011; Crabtree et al., 2001,2003; Dhawan et al., 2009, 2016; El-Gohary et al., 2014; Gaar-enstroom and Hill, 2014; Macias et al., 2015; Nomura et al.,2014; Smart et al., 2006; Stewart et al., 2015; Xiao et al., 2014,2016; Zhou et al., 2013). Both Trithorax and SMAD signalinghave been implicated in beta cell proliferation in humaninsulinoma (Wang et al., 2017). Thus, we queried whetherR-SMADS 2, 3, and/or 4 might directly interact with regulatoryregions of the CDKN1A and/or CDKN1C genes in human isletsCell Metabolism 29, 638–652, March 5, 2019 643 (Figures 5A and 5B). Indeed, SMADs 2/3 and 4 associate withpromoter and enhancer regions of CDKN1A and CDKN1C (blackbars in Figures 5C and 5D) defined by Pasquali et al. (2014), andthese associations were altered by treatment with the harmine-TGFbinhibitor combination (white bars). Notably, MEN1, aTrithorax member and H3K4 methylase, was also observed tobind to some of these same regions in CDKN1A and CDKN1C,and these associations were also altered by harmine-TGFbin-hibitor treatment (Figures 5C and 5D). Finally, the H3K27 deme-thylase KDM6A, also a Trithorax member that binds specificallyto the CDKN1C promoter in FACS-sorted human beta cells(Wang et al., 2017), co-localizes with MEN1 on the CDKN1A pro-moter in human islets, and this association is diminished byharmine-TGFbinhibitor treatment (Figure 5C). Paradoxically, incontrast to results with MEN1, while KDM6A associates withthe CDKN1C locus in human islets, this association appears tobe enhanced rather than reduced with harmine-TGFbinhibitortreatment (Figure 5D). Taken together, these observationsmake it clear that R-SMADs, MEN1, and KDM6A do indeeddirectly or indirectly bind to the regulatory regions of CDKN1Aand CDKN1C in human islets, and do so in regions also occupiedby Trithorax members. Importantly, these associations are dis-rupted by harmine-TGFbinhibitor treatment. Collectively, thesefindings are consistent with a model (Figures 5E and 5F) in whichSMAD-Trithorax interactions maintain CDKN1A and CDKN1Cexpression in beta cells under basal circumstances, under the in-fluence of TGFbSF-mediated SMAD signaling in coordinationwith a Trithorax-mediated open chromatin state at these loci.Following harmine-TGFbinhibitor treatment, these complexesappear to dissociate or remodel, apparently disrupting SMADtransactivation of the CDKN1A and CDKN1C loci.Combined Harmine-TGFbInhibitor Treatment EnhancesMouse and Human Beta Cell Proliferation and MouseBeta Cell Expansion In VivoAll of the preceding studies were performed in human isletsin vitro. To determine whether comparable effects could beobserved in vivo, we employed three models. First, we exploredABCDEFFigure 4. Changes in Cell-Cycle Molecule Expression in Response to Harmine, LY364947, ALK5 Inhibitor, and the Combination(A) The effects of vehicle (DMSO 0.1%), harmine (10 mM), LY364947 (5 mM), or the combination for 96 hr on gene expression in dispersed human islets for cell-cycle activators, as assessed using qPCR.(B) Comparable results for cell-cycle inhibitors.(C and D) The effect of silencing SMADs 2,3,4 or overexpressing SMADs 6 and/or 7 on expression of CDKN1A (C) and CDKN1C (D) in human islets as assessedusing qPCR.(E) The effects of silencing CDKN1A,CDKN1C, and the combination on Ki67 immunolabeling in human beta cells in the presence or absence of 10 mM harmine.(F) The effects of overexpression of CDKN1A,CDKN1C, and CDKN2B in dispersed human islets for 96 hr on proliferation induced by the harmine-LY364947combination.All experiments represent five human islet preparations, and error bars represent mean ± SEM. *p 0.05 versus control and **p 0.05 versus harmine. Numbersof donors and beta cells counted are provided in Table S3.644 Cell Metabolism 29, 638–652, March 5, 2019 the combined effects of a maximally effective dose of harmine(10 mg/kg i.p. [intraperitoneally]) (Wang et al., 2015a) with ALK5inhibitor II, SB431542, LY364947, and GW788388, administeredonce per day for 7 days, on Ki67 beta cell labeling in endogenouspancreatic beta cells of C57BL6 mice. Among these, the combi-nation of harmine (10 mg/kg/day) together with GW788388(30 mg/kg/day) proved most effective (Figures 6A and 6B), andwas selected for subsequent studies. As reported previously,harmine (Wang et al., 2015a) and TGFbSF inhibitors (Dhawanet al., 2016; Xiao et al., 2014; Zhou et al., 2013) individuallyinduce proliferation in mouse beta cells in vivo. However, asobserved in vitro, combined treatment in vivo with harmine andGW788388 produced a substantially larger effect than eitheralone, achieving an in vivo beta cell labeling index of 2%.Second, to determine if the proliferation noted with Ki67 label-ing might translate into actual beta cell regeneration in vivo,weused the partial (60%) pancreatectomy (PPX) mouse model (Fig-ures 6C, 6D, S5B, and S6)(Wang et al., 2015a). Mice undergoingsham PPX showed no significant change in beta cell mass after7 days of treatment, although mice treated with the harmine-GW788388 combination appeared to be trending upward.Most importantly, beta cell mass had expanded significantlywithin 7 days in mice that underwent a 60% PPX followed bythe harmine-GW788388 combination. In contrast, the threecontrol groups remained substantially below normal.Finally, we queried whether systemic treatment with the har-mine-GW788388 combination could enhance beta cell prolifera-tion in transplanted human islets in vivo in the NOD-SCID mouseABCDEFFigure 5. Direct Interaction of SMADs and Trithorax Members with the CDKN1A and CDKN1C Loci in Human Islets(A and B) Schematics of the human CDKN1A (A) and CDKN1C (B) loci from the hg19 UCSC genome browser, showing PCR products amplified in the primer pairsused for ChIP in the small black boxes, the gene bodies in blue below, and enhancers and promoters in orange and black, respectively. Enhancer and promoterloci are derived from Pasquali and Ferrer (Pasquali et al., 2014).(C and D) ChIP results in control (black bars) and harmine-LY364947-treated (white bars) human islets, with primer pairs corresponding to (A) and (B) along thex axis. Primer pairs and locations for CDKN1A (C) and CDKN1C (D) are derived from Koinuma et al. (2009), Pasquali et al. (2014), and Yang et al. (2009).Experiments were performed on dispersed human islets. Drug treatment lasted for 96 hr. Error bars indicate SEM. Each experiment represents the mean ofaminimum of three sets of human islets.(E and F) Schematics indicating interactions of the SMADs and Trithorax members under basal conditions (E) and following harmine-LY364947 treatment (F),respectively, illustrating that harmine-LY364947 treatment markedly alters SMAD-Trithorax binding to the CDKN1A and CDKN1C loci. Numbers of donors andbeta cells counted are provided in Table S3.Cell Metabolism 29, 638–652, March 5, 2019 645 model (Figures 6E and 6F). As observed previously (Wang et al.,2015a), harmine treatment induced human beta cell proliferationin vivo, as did GW788388. Most notably, and as occurred withhuman beta cells in vitro and with mouse beta cells in vivo, treat-ment with the harmine-GW788388 combination was substan-tially more effective in driving human beta cell proliferation in vivothan either agent alone, yielding degrees of beta cell proliferationin transplanted human islets in vivo not previously observed byourselves (Wang et al., 2015a) or others (Dhawan et al., 2016;Dirice et al., 2016) in response to any drug, nutrient, or growthfactor. Importantly, beta cells from four of the five islet donorsdisplayed greater Ki67 immunolabeling in the harmine plusGW788388 group than in the three other groups.DISCUSSIONWe provide a number of important new observations. First, wedescribe a novel combination of two distinct classes of mole-cules—a DYRK1A inhibitor combined with a TGFbsuperfamilyinhibitor—that reliably induces ‘‘rates’’ of proliferation in matureACEBDFFigure 6. Effects of the Harmine-TGFbInhibitor Combination in Three In Vivo Models(A) Intraperitoneal administration of saline (control), 10 mg/kg/day harmine, 30 mg/kg/day GW788388 (GW), or the combination of 10 mg/kg harmine plus30 mg/kg/day GW788388 daily for 7 days. After 7 days of treatment, the pancreata were harvested and Ki67 and insulin immunolabeling quantified. The numbersof animals in each group are shown within the bars. A minimum of 2,000 beta cells were counted for each bar shown. Error bars indicate SEM. *p 0.05 versuscontrol, #p 0.01 versus harmine or GW alone, and **p 0.01 versus control, by one-way Bonferroni corrected ANOVA.(B) Examples of Ki67 (red), DAPI (blue), and insulin (green) immunolabeling in each of the four groups in (A). Arrows indicate examples of Ki67+beta cells.(C) The effects on total beta cell mass in eight groups of eight C57BL/6N mice receiving daily intraperitoneal vehicle (saline), harmine (10 mg/kg), GW788388(30 mg/kg), or the harmine-GW788388 combination for 7 days following sham or real 60% pancreatectomy (PPX). Error bars indicate SEM, *p 0.05 versus shamPPX animals, and **p 0.05 versus harmine or GW 30-treated PPX mice.(D) Examples of pancreas remnants immunolabeled for insulin from mice undergoing PPX treated with control (saline) or the harmine-GW788388 combination.See Figure S6 for details.(E) The effects of control vehicle (saline), intraperitoneal harmine (10 mg/kg), GW788388 (30 mg/kg), or the harmine-GW788388 combination on human beta cellproliferation for 7 days in five sets of four NOD-SCID mice that received renal capsular islet transplants with 1,000 human islet equivalents from five different isletdonors, indicated by the squares, triangles, closed circles, open circles, and ‘‘X’’ symbols. A minimum of 2,000 beta cells were counted for each bar shown. Errorbars indicate SEM, *p 0.05 versus control islets, and **p 0.05 versus harmine and GW788388.(F) Examples of Ki67 (red) and insulin (green) immunolabeling in human islets as in (D). Arrows indicate examples of Ki67+beta cells.646 Cell Metabolism 29, 638–652, March 5, 2019 adult human beta cells averaging 5%–8%, rates not previouslybeen observed with any class of therapeutic molecules, andwhich far exceed normal physiological pancreatic beta cell repli-cation in the first year of life (Gregg et al., 2012; Kassem et al.,2000; Meier et al., 2008; Wang et al., 2015b). Second, we illus-trate that this is a class effect, achieved by many differentDYRK1A inhibitors and many different TGFbsuperfamily inhibi-tors. Third, we demonstrate that the DYRK1A inhibitor-TGFbSFinhibitor combination behaves synergistically, and provide novelmechanisms and models for this synergy (Figure 7A). Fourth, wedemonstrate that beta cell numbers actually increase in threedifferent models, two human and one murine. Fifth, we providemechanistic explanations, using both pharmacologic and ge-netic approaches, for the concept that simultaneous inhibitionof DYRK1A and SMAD signaling is both necessary and sufficientfor the synergy. Sixth, we document that the beneficial effects onhuman proliferation are achieved in part via modulation of the ac-tivities of chromatin-modifying, epigenetic-modulating enzymesof the Trithorax family, and extend Trithorax beta cell modulatoryinvolvement to KDM6A and likely additional Trithorax members(Figure 7B). Seventh, we observe that beta cell proliferationgenerated by the harmine-TGFbSF inhibitor combination isnot associated with beta cell de-differentiation, and insteadfavors maintained or increased beta cell differentiation. Eighth,the beneficial mitogenic and pro-differentiation effects of theDYRK1A inhibitor-TGFbSF inhibitor combination extend tobeta cells from people with type 2 diabetes. Ninth, we add leu-cettine-41 (Tahtouh et al., 2012) to the growing list of small-mole-cule DYRK1A inhibitors that are able to activate human beta cellproliferation. Tenth, we extend the induction of proliferationin vitro to three distinct mouse and human in vivo models. Elev-enth, the observations strongly suggest that locally producedendogenous TGFbSF agonists such as TGFbs activins, inhibins,BMPs, and related molecules play a key physiologic role in re-straining beta cell mass expansion, and that this inhibitorypathway can be manipulated for therapeutic purposes. Finally,while DYRK1A remains a central target of harmine and otherDYRK1A inhibitors, we suggest that harmine also may act inpart via SMAD pathways as well.While DYRK1A inhibitors such as harmine, 5-IT, INDY, andGNF4877 have been shown to induce replication in humanbeta cells, the ‘‘rates’’ of proliferation or labeling indices havebeen low, in the 1.5%–3% range in vitro (Aamodt et al., 2016;Abdolazimi et al., 2018; Dirice et al., 2016; Shen et al., 2015;Wang et al., 2015a, 2016), and far lower in in vivo transplantmodels (Dirice et al., 2016; Wang et al., 2015a). Thus, while har-mine analog-induced beta cell proliferation is an importantadvance, one might envision higher rates of proliferation as be-ing required for therapeutic human beta cell expansion intype 1 and type 2 diabetes. The average ‘‘rates’’ in the 5%–8%range obtained with the DYRK1A inhibitor-TGFbinhibitor combi-nation (Figures 1 and 2) are notable in this regard.TGFbinhibitors and SMAD inhibition are well known as activa-tors of proliferation in rodent islets (Brown and Schneyer, 2010;Brown et al., 2014; Dhawan et al., 2016; El-Gohary et al., 2014;Mukherjee et al., 2007; Nomura et al., 2014; Smart et al., 2006;Xiao et al., 2014, 2016; Zhou et al., 2013). For example, Schneyeret al. demonstrated in 2007 that knockout of the endogenous ac-tivin inhibitor follistatin-like-3 leads to beta cell expansion inmouse genetic models (Mukherjee et al., 2007). Teramoto et al.have reported that beta cell-specific disruption of smad2 leadsto beta cell hyperplasia (Nomura et al., 2014). Kim and Gitteshave both reported that spontaneous or inducible upregulationof the I-SMAD smad7 is associated with beta cell proliferationand expansion in mice (Smart et al., 2006; Xiao et al., 2014,2016). And Bhushan, Kulkarni et al. have used small-moleculeTGFbreceptor inhibitors to activate proliferation in mousepancreatic beta cells (Dhawan et al., 2016; Zhou et al., 2013).When examined in adult human islets, however, beta cell prolif-eration in response to TGFbSF inhibitors has been modest ornegligible (Dhawan et al., 2016), a result we confirm (Figure 1A).One important advance herein was to employ TGFbinhibitorsin combination with harmine, a concept we derived from humaninsulinoma data mining, wherein both DYRK1A and SMADpathway abnormalities are evident (Wang et al., 2017). More-over, we observe that inhibiting many of the various classes ofTGFbsuperfamily receptors, including TGFb, activin, and BMPreceptors, in the presence of harmine, is effective in permittingbeta cell proliferation. We also find, as reported previously(Brown et al., 2014), that TGFbsuperfamily members andSMAD signaling pathways are abundant in human islets. We inferthat these collectively comprise an inhibitory regulatory networkthat restrains human beta cell proliferation, perhaps, as sug-gested by Gittes and Kim, to protect against de-differentiationFigure 7. Models of TGFbSuperfamilySignaling and Harmine-TGFbSuperfamilyActions on Human Beta Cell Proliferation(A) A simplified illustration of the synergisticmechanisms through which harmine and TGFbSFpathway inhibitors cooperate to enhance humanbeta cell proliferation. Harmine, acting on DYRK1A,primarily activates cyclins, cdks, and relatedcell-cycle activators. In parallel, TGFbSF pathwayinhibitors relieve expression of cell-cycle in-hibitors, including CDKN1A encoding p21CIP,CDKN1C encoding p57KIP, and CDKN2B en-coding p15INK4. As suggested in Figure 3A,harmine also has direct or indirect effects on TGFbSF-SMAD signaling, and it is likely that DYRK1A has effects on other targets in addition to NFaTs.(B) In the canonical TGFbparadigm, ligands such as TGFb, activins, inhibins, myostatin, GDF11, and bone morphogenic proteins (BMPs) bind to multi-subunitreceptors that phosphorylate, and thereby activate, so-called receptor SMADs (SMADs 2,3, and 1,5,8/9). These are then able to heteromerize with SMAD4, acommon SMAD, and the SMAD4 heteromers translocate to the nucleus where, among other things, they are incorporated into the chromatin-modifying and DNA-methylating Trithorax complex, and thereby influence expression of multiple gene families. Adapted from Brown and Schneyer (2010).Cell Metabolism 29, 638–652, March 5, 2019 647 (Smart et al., 2006; Xiao et al., 2014, 2016), or perhaps againstinappropriate beta cell expansion that might cause dangeroushypoglycemia, as occurs in insulinoma and congenital hyperin-sulinism. Importantly, the efficacy of the harmine-TGFbSF inhib-itor combination translates from purely in vitro systems to threedifferent in vivo models.Another key advance is the demonstration that the increasesin beta cell proliferation implied by elevated Ki67, BrdU, andpHH3 labeling measures widely used in beta cell biology actuallytranslate into increases in numbers of human beta cells. It hasbeen challenging to demonstrate actual increases in humanbeta cell numbers in response to any agent. Laffitte observedan increase in human beta cell numbers in vitro in response toGNF4877 using advanced imaging techniques (Shen et al.,2015). Fiaschi-Taesch, using complex imaging and image anal-ysis, also showed that cyclin and cyclin-dependent kinase over-expression using gene therapy approaches was able to increasehuman beta cell numbers (Tiwari et al., 2015). And Kerr-Conteet al. suggested that transplanted human islet cell mass can in-crease in response to high-fat feeding (Gargani et al., 2013).Each of these models is tedious and/or requires advanced imag-ing equipment, barriers to their widespread adoption. Not sur-prisingly, therefore, none of these approaches has been widelyadopted. Here, we report a straightforward flow cytometricmethod to assess actual human beta cell numbers, and demon-strate its ease and efficacy in two different human beta cellmodels. Using this method, we find that adult beta cell numbersare approximately 50% higher in human islets treated for 4 dayswith the harmine-TGFbinhibitor combination than control islets(Figure 1H). This is in the general range that might be anticipatedwith a proliferation rate of 5%–8%. For example, one might pre-dict conservatively that a labeling index of 5%–8%/day over4 days would lead to a 22%–36% increase in beta cell numbers.Along the same lines, in the Mel1-hESC experiments, whichcontinued for 7 days, one might assume a 50%–70% increasein beta cell numbers, approximating the near doubling observed(Figure 1I). Of course, these calculations are approximate andrely on imperfect assumptions, but may suggest that the Ki67labeling indices actually underestimate the true rate of beta cellproliferation. Thus, alternately or in addition, they may reflectadditional beneficial effects on beta cell survival, on enhancedbeta cell differentiation, and/or on transdifferentiation from otherislet cell types. Whatever the mechanisms, increases in humanbeta cell numbers of this magnitude following 4–7 days oftreatment would be a welcome addition to the regenerativearmamentarium.We find that the DYRK1A inhibitor-TGFbSF inhibitor combina-tion is not merely additive, but clearly synergistic (Figures 1,S1A,and S1B). Mechanistically, DYRK1A inhibitors seem to preferen-tially activate cell-cycle activators, such as cyclins and cdks,whereas the TGFbSF inhibitors seem to preferentially represscell-cycle inhibitors, notably CDKN1A,CDKN1C, and CDKN2B,effects that appear to be mediated, at least for CDKN1A andCDKN1C, by SMAD signaling and Trithorax chromatin remodel-ing. While we find clear evidence for TGFbsuperfamily membereffects being mediated by CDKN1A and CDKN1C, documentinginvolvement of CDKN2B and CDKN2A is more difficult becausethey arise from a common locus that encodes additional cell-cycle modulators such as p14ARF, ANRIL, and others. Theseissues, and the unusually GC-rich nature of this locus, makeselective silencing of CDKN2A and CDKN2B challenging. Finally,while the apparent complementary actions of DYRK1A inhibitorsand TGFbsuperfamily inhibitors, illustrated in Figure 7A, likelyexplain much of the apparent synergy, they are unlikely theexclusive mechanism for the observed synergy, as evidencedby the ability of harmine alone to modulate expression and abun-dance of TGFbsuperfamily members (Figure 3A; Table S2).Indeed, several reports indicate that DYRK1A can phosphorylatea broad range of targets in addition to the NFaT family, includingTau, TP53, p27CIP, and the DREAM complex member LIN52 (Ab-dolazimi et al., 2018; Branca et al., 2017; Litovchick et al., 2011;Park et al., 2010; Sadasivam and DeCaprio, 2013). We thusspeculate that currently unknown additional targets likely existthat may lead to destabilization and/or dephosphorylation ofSMADs as observed in Figure 3A. Clarification of these additionalmechanisms in future studies is warranted.The involvement of the Trithorax family of epigenetic modifyinggenes in controlling beta cell growth is not unexpected. The ca-nonical Trithorax member MEN1 was positionally cloned frompeople with the multiple endocrine neoplasia type 1 syndrome(Chandrasekharappa et al., 1997), which includes insulinomas.MEN1 and other Trithorax members have been shown to regu-late beta cell proliferation and mass in animal models and celllines (Crabtree et al., 2001, 2003; Dhawan et al., 2016; Karniket al., 2005; Zhou et al., 2013). Moreover, MEN1 and otherTrithorax members, such as MLLs, have also been shown toparticipate in rodent beta cell proliferation and directly bind usingchromatin immunoprecipitation (ChIP) to cell-cycle inhibitor loci(Dhawan et al., 2016; Zhou et al., 2013). In addition, anotherTrithorax member, KDM6A, has recently been shown to berecurrently inactivated in human insulinomas (Wang et al.,2017); silencing or pharmacologically inhibiting KDM6A in hu-man beta cells can block expression of the cell-cycle inhibitorCDKN1C (Wang et al., 2017). Here, we extend these observa-tions by showing that the DYRK1A inhibitor-TGFbSF inhibitorcombination disrupts normal physical interactions amongMEN1 and KDM6A with CDKN1A and CDKN1C promoters andenhancers, and provide for the first time an example of har-mine-TGFbSF inhibition modulating the binding of the canonicalTrithorax member MEN1 to regulatory regions of the key cell-cycle inhibitor CDKN1C in human islets. Since these studieswere performed in whole islets, additional studies will berequired to elucidate which events actually occur in beta cells.Similarly, genome-wide studies such as ChIP-seq and ATAC-seq using purified beta cells will be required to document andclarify specific interactions on a genome-wide basis.Accili and collaborators have reported that type 2 diabetes inmouse and human beta cells is associated with de-differentia-tion to a more primitive, and poorly functional, insulin-depletedneuroendocrine cell type (Talchai et al., 2012). As was the casewith harmine (Wang et al., 2015a), the harmine-TGFbSF inhibitorcombination increased several key markers of human beta cellidentity, differentiation, and maturity, including NKX6.1,PDX1,MAFA,MAFB,SLC2A2, and PCSK1 (Figures 2A–2C; TableS2). We presume, but have not experimentally confirmed, thatthis relates in part to DYRK1A inhibition with resultant NFaTnuclear translocation and binding to promoters of this classof genes, as documented by Kim et al. in mouse beta cells648 Cell Metabolism 29, 638–652, March 5, 2019 (Goodyer et al., 2012; Heit et al., 2006). The observation thatsome, but not all, presumptive beta cell differentiation factorsare increased in human islets treated with the harmine-TGFbin-hibitor combination is reminiscent of observations of Sekineet al. (1994) and Klochendler et al. (2016), who observed thatproliferating Ins1 cells (Sekine et al., 1994) or mouse beta cells(Klochendler et al., 2016) display varying effects on key betacell functions, such as reducing lactate dehydrogenase (LDH) ac-tivity, and on transcriptomic readouts. For example, abundanceof mRNAs encoding the key beta cell transcription factorsNkx6.1,Mafa, and Pdx1 remained normal in proliferating mousebeta cells, while transcripts encoding genes involved in secretorygranule function such as secretogranin V (Scg5), Pcsk1, Vamp4,carboxypeptidase (Cpe), and Rab3a were reduced. Clarifyingsuch complex events will require studies in single cells, at multi-ple time points, and in response to multiple treatments, and in is-lets from normals and people with type 2 diabetes, employingtechnologies such as single-cell RNA-seq, CyTOF analysis, andmicrosecretion studies from individual beta cells. From a thera-peutic standpoint, the fact that a differentiated molecular pheno-type and glucose-stimulated insulin secretion remain intactdespite induction of proliferation in normal (Figures 2A–2D) andtype 2 diabetes islets (Figures 2E and 2F) bodes well for treatmentof people with type 2 diabetes, and merits further exploration.Limitations of StudyA number of important additional challenges remain in the field ofbeta cell regenerative research. First, this study employed isletsfrom 104 different human islet donors, illustrating a major chal-lenge the field of regenerative beta cell biology faces. The fieldlacks easy and affordable access to large numbers of humanislets, which themselves are remarkably heterogeneous; un-equivocal, universally accepted approaches to high-throughput,high-precision human cadaveric beta cell drug screening andquantitation; and perfect model cell lines with which to performsuch studies.Second, beta cell targeting remains a major challenge. SinceSMAD and DYRK1A signaling are ubiquitous, the DYRK1A inhib-itor-TGFbSF inhibitor strategy will certainly have off-targeteffects on many tissues, as illustrated by the CNS effects ofharmine (Brierley and Davidson, 2012; Heise and Brooks,2017) and the mitogenic effects of the harmine-TGFbSF inhibitoreffects on alpha and ductal cells (Figure S3). At this moment,there is no molecule that is able to target or deliver any drug spe-cifically to the beta cell, an observation that has prompted urgentrequests for such targeting molecules from diabetes fundingagencies. Thus, one might envision a future in which drugssuch as harmine and TGFbinhibitors might be administered sys-temically and delivered directly and specifically to human betacells—but not to other cell types—via carrier or transport mole-cules such as beta cell-specific GLP1 analogs, monoclonal anti-bodies, RNA aptamers, and/or zincophilic delivery molecules.Alternately, one might imagine using the drug combination toexpand human islets ex vivo prior to transplantation.A third concern relates to the potential long-term effect ofTGFbSF inhibitors to cause de-differentiation in beta cells.Both Gittes and Kim have reported in mouse models that upre-gulation or overexpression of the I-SMAD smad7 in beta cellsover the longer term results in beta cell de-differentiation, butthat re-differentiation occurs in association with termination ofthe SMAD7 signal (Smart et al., 2006; Xiao et al., 2014, 2016).Teramoto et al. report that knockout of the R-SMAD smad2also induces beta cell de-differentiation (Nomura et al., 2014).These observations predict that continuous long-term TGFbSFinhibition may result in human beta cell de-differentiation, andthat cyclical dosing strategies may be required, as is commonlyemployed with TGFbSF inhibitors in current clinical use (Cohnet al., 2014; Herbertz et al., 2015; Mascarenhas et al., 2014;Necchi et al., 2014; Trachtman et al., 2011; Yanagita, 2012). Afourth challenge is that proliferation rates appear less robustin vivo (2%) than in vitro (5%–8%), a result that we speculatereflects the greater abundance of TGFbSF ligands in the in vivoenvironment versus in vitro. Of particular relevance here is theobservation that although the TGFbinhibitor GW788388 hadno mitogenic effect on human beta cells in vitro (Figure 1A), itdid increase proliferation in vivo (Figures 6E and 6F). This mayprovide additional support for the concept that endogenousTGFbSF ligands serve as important in vivo physiologic repres-sors of adult human beta cell replication.Finally, while these strategies appear to be promising for bothtype 1 and type 2 diabetes, they may be particularly attractive intype 2 diabetes, since residual beta cell mass is substantiallyhigher in type 2 than in type 1 diabetes, and since autoimmunityis not operative. Most important, these studies support the pos-sibility that restorative treatment of beta cell deficiency and func-tion in type 1 and type 2 diabetes is achievable.STAR+METHODSDetailed methods are provided in the online version of this paperand include the following:dKEY RESOURCES TABLEdCONTACT FOR REAGENT AND RESOURCE SHARINGdEXPERIMENTAL MODEL AND SUBJECT DETAILSBHuman Pancreatic Islet StudiesBMouse StudiesdMETHOD DETAILSBAdenoviruses and TransductionBQuantitative PCRBRNA sequencingBImmunocytochemistryBImmunoblottingBGlucose-Stimulated Insulin SecretionBProliferation in HUES8-Derived Human Beta CellsBExpansion and Differentiation of Mel1-Derived BetaCells: Stem cell line and cultureBDifferentiation of Mel1 Cells into Pancreatic IsletsBFlow Cytometry to Quantify Human Beta CellsBChromatin Immunoprecipitation (ChIP) AssaysdQUANTIFICATION AND STATISTICAL ANALYSISBStatisticsdDATA AND SOFTWARE AVAILIBILITYSUPPLEMENTAL INFORMATIONSupplemental Information includes seven figures and three tables and can befound with this article online at https://doi.org/10.1016/j.cmet.2018.12.005.Cell Metabolism 29, 638–652, March 5, 2019 649 ACKNOWLEDGMENTSThe authors wish to thank Bonnie and Joel Bergstein and Thomas and LonnieSchwartz for their support of this project. We thank NIDDK Integrated Islet Dis-tribution Program (IIDP), Dr. Tatsuya Kin at the University of Edmonton, andDr. Patrick MacDonald at the Alberta Diabetes Institute for supplying humancadaveric islets, and The Human Islet and Adenoviral Core (HIAC) of the Ein-stein-Sinai Diabetes Research Center (DRC) at the Icahn School of Medicineat Mount Sinai for support in developing the many human adenovirusesdescribed in this project. We thank Dr. Martin Walsh for advice with ChIPstudies. We also thank the Genomics and Flow Cytometry Cores at the IcahnSchool of Medicine at Mount Sinai. This work was supported by seed fundingfrom the Icahn School of Medicine at Mount Sinai; by NIDDK grants R-01 DK105015, R01 DK108905, UC4 DK104211, P-30 DK 020541, and R-01DK116873; by JDRF grant 2-SRA-2017 514-S-B; and by ADA grant 1-16-ICTS-029.AUTHOR CONTRIBUTIONSP.W., E.K., H.L., E.S., C. Ackeifi, B.J.G., V.Z., A.B., K.K.T., L.Y., J.W., andA.G.-O. performed experiments. P.W. and A.F.S. conceived of the overallstrategy. P.W., E.K., D.K.S., D.H., D.E., G.H., F.P., C. Argmann, A.G.-O., andA.F.S. analyzed and interpreted data. P.W., E.K., G.H., D.K.S., A.G.-O. andA.F.S. wrote the manuscript.DECLARATIONS OF INTERESTA.F.S. and P.W. are inventors on a patent that has been filed by the IcahnSchool of Medicine at Mount Sinai. G.H., L.Y., and F.P. are employees ofSemma Therapeutics.Received: March 20, 2018Revised: August 3, 2018Accepted: November 30, 2018Published: December 20, 2018REFERENCESAamodt, K.I., Aramandla, R., Brown, J.J., Fiaschi-Taesch, N., Wang, P.,Stewart, A.F., Brissova, M., and Powers, A.C. (2016). Development of a reliableautomated screening system to identify small molecules and biologics thatpromote human b-cell regeneration. Am. J. Physiol. Endocrinol. Metab. 311,E859–E868.Abdolazimi, Y., Zhao, Z., Lee, S., Xu, H., Allegretti, P., Horton, T.M., Yeh, B.,Moeller, H.P., Nichols, R.J., McCutcheon, D., et al. (2018). CC-401 promotesb-cell replication via pleiotropic consequences of DYRK1A/B inhibition.Endocrinology 159, 3143–3157.Antebi, Y.E., Linton, J.M., Klumpe, H., Bintu, B., Gong, M., Su, C., McCardell,R., and Elowitz, M.B. (2017). Combinatorial signal perception in the BMPpathway. Cell 170, 1184–1196.e24.Avrahami, D., Li, C., Yu, M., Jiao, Y., Zhang, J., Naji, A., Ziaie, S., Glaser, B.,and Kaestner, K.H. (2014). Targeting the cell cycle inhibitor p57Kip2 promotesadult human bcell replication. J. Clin. Invest. 124, 670–674.Branca, C., Shaw, D.M., Belfiore, R., Gokhale, V., Shaw, A.Y., Foley, C., Smith,B., Hulme, C., Dunckley, T., Meechoovet, B., et al. (2017). Dyrk1 inhibition im-proves Alzheimer’s disease-like pathology. Aging Cell 16, 1146–1154.Brierley, D.I., and Davidson, C. (2012). Developments in harmine pharma-cology–implications for ayahuasca use and drug-dependence treatment.Prog. Neuropsychopharmacol. Biol. Psychiatry 39, 263–272.Brown, M.L., and Schneyer, A.L. (2010). Emerging roles for the TGFbeta familyin pancreatic beta-cell homeostasis. Trends Endocrinol. Metab. 21, 441–448.Brown, M.L., Ungerleider, N., Bonomi, L., Andrzejewski, D., Burnside, A., andSchneyer, A. (2014). Effects of activin A on survival, function and gene expres-sion of pancreatic islets from non-diabetic and diabetic human donors. Islets6, e1017226.Chandrasekharappa, S.C., Guru, S.C., Manickam, P., Olufemi, S.E., Collins,F.S., Emmert-Buck, M.R., Debelenko, L.V., Zhuang, Z., Lubensky, I.A.,Liotta, L.A., et al. (1997). Positional cloning of the gene for multiple endocrineneoplasia-type 1. Science 276, 404–407.Chen, H., Gu, X., Su, I.H., Bottino, R., Contreras, J.L., Tarakhovsky, A., andKim, S.K. (2009). Polycomb protein Ezh2 regulates pancreatic beta-cellInk4a/Arf expression and regeneration in diabetes mellitus. Genes Dev. 23,975–985.Chen, H., Gu, X., Liu, Y., Wang, J., Wirt, S.E., Bottino, R., Schorle, H., Sage, J.,and Kim, S.K. (2011). PDGF signalling controls age-dependent proliferation inpancreatic b-cells. Nature 478, 349–355.Cinti, F., Bouchi, R., Kim-Muller, J.Y., Ohmura, Y., Sandoval, P.R., Masini, M.,Marselli, L., Suleiman, M., Ratner, L.E., Marchetti, P., and Accili, D. (2016).Evidence of b-cell dedifferentiation in human type 2 diabetes. J. Clin.Endocrinol. Metab. 101, 1044–1054.Cohn, A., Lahn, M.M., Williams, K.E., Cleverly, A.L., Pitou, C., Kadam, S.K.,Farmen, M.W., Desaiah, D., Raju, R., Conkling, P., and Richards, D. (2014).A phase I dose-escalation study to a predefined dose of a transforming growthfactor-b1 monoclonal antibody (TbM1) in patients with metastatic cancer. Int.J. Oncol. 45, 2221–2231.Cozar-Castellano, I., Takane, K.K., Bottino, R., Balamurugan, A.N., andStewart, A.F. (2004). Induction of beta-cell proliferation and retinoblastomaprotein phosphorylation in rat and human islets using adenovirus-mediatedtransfer of cyclin-dependent kinase-4 and cyclin D1. Diabetes 53, 149–159.Crabtree, J.S., Scacheri, P.C., Ward, J.M., Garrett-Beal, L., Emmert-Buck,M.R., Edgemon, K.A., Lorang, D., Libutti, S.K., Chandrasekharappa, S.C.,Marx, S.J., et al. (2001). A mouse model of multiple endocrine neoplasia,type 1, develops multiple endocrine tumors. Proc. Natl. Acad. Sci. USA 98,1118–1123.Crabtree, J.S., Scacheri, P.C., Ward, J.M., McNally, S.R., Swain, G.P.,Montagna, C., Hager, J.H., Hanahan, D., Edlund, H., Magnuson, M.A., et al.(2003). Of mice and MEN1: insulinomas in a conditional mouse knockout.Mol. Cell. Biol. 23, 6075–6085.Demozay, D., Tsunekawa, S., Briaud, I., Shah, R., and Rhodes, C.J. (2011).Specific glucose-induced control of insulin receptor substrate-2 expressionis mediated via Ca2+-dependent calcineurin/NFAT signaling in primarypancreatic islet b-cells. Diabetes 60, 2892–2902.Dhawan, S., Tschen, S.I., and Bhushan, A. (2009). Bmi-1 regulates the Ink4a/Arf locus to control pancreatic beta-cell proliferation. Genes Dev. 23, 906–911.Dhawan, S., Dirice, E., Kulkarni, R.N., and Bhushan, A. (2016). Inhibition ofTGF-bsignaling promotes human pancreatic b-cell replication. Diabetes 65,1208–1218.Dirice, E., Walpita, D., Vetere, A., Meier, B.C., Kahraman, S., Hu, J., Dancı´k, V.,Burns, S.M., Gilbert, T.J., Olson, D.E., et al. (2016). Inhibition of DYRK1A stim-ulates human b-cell proliferation. Diabetes 65, 1660–1671.El-Gohary, Y., Tulachan, S., Wiersch, J., Guo, P., Welsh, C., Prasadan, K.,Paredes, J., Shiota, C., Xiao, X., Wada, Y., et al. (2014). A smad signalingnetwork regulates islet cell proliferation. Diabetes 63, 224–236.Fiaschi-Taesch, N., Bigatel, T.A., Sicari, B., Takane, K.K., Salim, F., Velazquez-Garcia, S., Harb, G., Selk, K., Cozar-Castellano, I., and Stewart, A.F. (2009).Survey of the human pancreatic beta-cell G1/S proteome reveals a potentialtherapeutic role for cdk-6 and cyclin D1 in enhancing human beta-cell replica-tion and function in vivo. Diabetes 58, 882–893.Fiaschi-Taesch, N.M., Kleinberger, J.W., Salim, F.G., Troxell, R., Wills, R.,Tanwir, M., Casinelli, G., Cox, A.E., Takane, K.K., Scott, D.K., and Stewart,A.F. (2013a). Human pancreatic b-cell G1/S molecule cell cycle atlas.Diabetes 62, 2450–2459.Fiaschi-Taesch, N.M., Kleinberger, J.W., Salim, F.G., Troxell, R., Wills, R.,Tanwir, M., Casinelli, G., Cox, A.E., Takane, K.K., Srinivas, H., et al. (2013b).Cytoplasmic-nuclear trafficking of G1/S cell cycle molecules and adult humanb-cell replication: a revised model of human b-cell G1/S control. Diabetes 62,2460–2470.Gaarenstroom, T., and Hill, C.S. (2014). TGF-bsignaling to chromatin: howSmads regulate transcription during self-renewal and differentiation. Semin.Cell Dev. Biol. 32, 107–118.650 Cell Metabolism 29, 638–652, March 5, 2019 Gargani, S., The´venet, J., Yuan, J.E., Lefebvre, B., Delalleau, N., Gmyr, V.,Hubert, T., Duhamel, A., Pattou, F., and Kerr-Conte, J. (2013). Adaptivechanges of human islets to an obesogenic environment in the mouse.Diabetologia 56, 350–358.Goodyer, W.R., Gu, X., Liu, Y., Bottino, R., Crabtree, G.R., and Kim, S.K.(2012). Neonatal bcell development in mice and humans is regulated by calci-neurin/NFAT. Dev. Cell 23, 21–34.Gregg, B.E., Moore, P.C., Demozay, D., Hall, B.A., Li, M., Husain, A., Wright,A.J., Atkinson, M.A., and Rhodes, C.J. (2012). Formation of a human b-cellpopulation within pancreatic islets is set early in life. J. Clin. Endocrinol.Metab. 97, 3197–3206.Heise, C.W., and Brooks, D.E. (2017). Ayahuasca exposure: descriptive anal-ysis of calls to US Poison Control Centers from 2005 to 2015. J. Med. Toxicol.13, 245–248.Heit, J.J., Apelqvist, A.A., Gu, X., Winslow, M.M., Neilson, J.R., Crabtree, G.R.,and Kim, S.K. (2006). Calcineurin/NFAT signalling regulates pancreatic beta-cell growth and function. Nature 443, 345–349.Herbertz, S., Sawyer, J.S., Stauber, A.J., Gueorguieva, I., Driscoll, K.E.,Estrem, S.T., Cleverly, A.L., Desaiah, D., Guba, S.C., Benhadji, K.A., et al.(2015). Clinical development of galunisertib (LY2157299 monohydrate), a smallmolecule inhibitor of transforming growth factor-beta signaling pathway. DrugDes. Devel. Ther. 9, 4479–4499.Karnik, S.K., Hughes, C.M., Gu, X., Rozenblatt-Rosen, O., McLean, G.W.,Xiong, Y., Meyerson, M., and Kim, S.K. (2005). Menin regulates pancre-atic islet growth by promoting histone methylation and expression ofgenes encoding p27Kip1 and p18INK4c. Proc. Natl. Acad. Sci. USA102, 14659–14664.Kassem, S.A., Ariel, I., Thornton, P.S., Scheimberg, I., and Glaser, B. (2000).Beta-cell proliferation and apoptosis in the developing normal humanpancreas and in hyperinsulinism of infancy. Diabetes 49, 1325–1333.Klochendler, A., Caspi, I., Corem, N., Moran, M., Friedlich, O., Elgavish, S.,Nevo, Y., Helman, A., Glaser, B., Eden, A., et al. (2016). The genetic programof pancreatic b-cell replication in vivo. Diabetes 65, 2081–2093.Koinuma, D., Tsutsumi, S., Kamimura, N., Imamura, T., Aburatani, H., andMiyazono, K. (2009). Promoter-wide analysis of Smad4 binding sites in humanepithelial cells. Cancer Sci. 100, 2133–2142.Litovchick, L., Florens, L.A., Swanson, S.K., Washburn, M.P., and DeCaprio,J.A. (2011). DYRK1A protein kinase promotes quiescence and senescencethrough DREAM complex assembly. Genes Dev. 25, 801–813.Macias, M.J., Martin-Malpartida, P., and Massague´, J. (2015). Structural de-terminants of Smad function in TGF-bsignaling. Trends Biochem. Sci. 40,296–308.Mascarenhas, J., Li, T., Sandy, L., Newsom, C., Petersen, B., Godbold, J., andHoffman, R. (2014). Anti-transforming growth factor-btherapy in patients withmyelofibrosis. Leuk. Lymphoma 55, 450–452.Meier, J.J., Butler, A.E., Saisho, Y., Monchamp, T., Galasso, R., Bhushan, A.,Rizza, R.A., and Butler, P.C. (2008). Beta-cell replication is the primary mech-anism subserving the postnatal expansion of beta-cell mass in humans.Diabetes 57, 1584–1594.Micallef, S.J., Li, X., Schiesser, J.V., Hirst, C.E., Yu, Q.C., Lim, S.M., Nostro,M.C., Elliott, D.A., Sarangi, F., Harrison, L.C., et al. (2012). INS(GFP/w) humanembryonic stem cells facilitate isolation of in vitro derived insulin-producingcells. Diabetologia 55, 694–706.Millman, J.R., Xie, C., Van Dervort, A., G€urtler, M., Pagliuca, F.W., and Melton,D.A. (2016). Generation of stem cell-derived b-cells from patients with type 1diabetes. Nat. Commun. 7, 11463.Mukherjee, A., Sidis, Y., Mahan, A., Raher, M.J., Xia, Y., Rosen, E.D., Bloch,K.D., Thomas, M.K., and Schneyer, A.L. (2007). FSTL3 deletion reveals rolesfor TGF-beta family ligands in glucose and fat homeostasis in adults. Proc.Natl. Acad. Sci. USA 104, 1348–1353.Necchi, A., Giannatempo, P., Mariani, L., Fare`, E., Raggi, D., Pennati, M.,Zaffaroni, N., Crippa, F., Marchiano`, A., Nicolai, N., et al. (2014). PF-03446962, a fully-human monoclonal antibody against transforming growth-factor b(TGFb) receptor ALK1, in pre-treated patients with urothelial cancer:an open label, single-group, phase 2 trial. Invest. New Drugs 32, 555–560.Nomura, M., Zhu, H.L., Wang, L., Morinaga, H., Takayanagi, R., and Teramoto,N. (2014). SMAD2 disruption in mouse pancreatic beta cells leads to islet hy-perplasia and impaired insulin secretion due to the attenuation of ATP-sensi-tive K+ channel activity. Diabetologia 57, 157–166.Pagliuca, F.W., Millman, J.R., G€urtler, M., Segel, M., Van Dervort, A., Ryu, J.H.,Peterson, Q.P., Greiner, D., and Melton, D.A. (2014). Generation of functionalhuman pancreatic bcells in vitro. Cell 159, 428–439.Park, J., Oh, Y., Yoo, L., Jung, M.S., Song, W.J., Lee, S.H., Seo, H., and Chung,K.C. (2010). Dyrk1A phosphorylates p53 and inhibits prolife ration of embryonicneuronal cells. J. Biol. Chem. 285, 31895–31906.Pasquali, L., Gaulton, K.J., Rodrı´guez-Seguı´, S.A., Mularoni, L., Miguel-Escalada, I., Akerman,_I., Tena, J.J., Mora´n, I., Go´mez-Marı´n, C., van deBunt, M., et al. (2014). Pancreatic islet enhancer clusters enriched in type 2 dia-betes risk-associated variants. Nat. Genet. 46, 136–143.Pullen, T.J., and Rutter, G.A. (2013). When less is more: the forbidden fruits ofgene repression in the adult b-cell. Diabetes Obes. Metab. 15, 503–512.Sadasivam, S., and DeCaprio, J.A. (2013). The DREAM complex: master coor-dinator of cell cycle-dependent gene expression. Nat. Rev. Cancer 13,585–595.Schuit, F., Van Lommel, L., Granvik, M., Goyvaerts, L., de Faudeur, G.,Schraenen, A., and Lemaire, K. (2012). b-cell-specific gene repression: amechanism to protect against inappropriate or maladjusted insulin secretion?Diabetes 61, 969–975.Sekine, N., Cirulli, V., Regazzi, R., Brown, L.J., Gine, E., Tamarit-Rodriguez, J.,Girotti, M., Marie, S., MacDonald, M.J., Wollheim, C.B., et al. (1994). Lowlactate dehydrogenase and high mitochondrial glycerol phosphate dehydro-genase in pancreatic beta-cells. Potential role in nutrient sensing. J. Biol.Chem. 269, 4895–4902.Shen, W., Taylor, B., Jin, Q., Nguyen-Tran, V., Meeusen, S., Zhang, Y.Q.,Kamireddy, A., Swafford, A., Powers, A.F., Walker, J., et al. (2015). Inhibitionof DYRK1A and GSK3B induces human b-cell proliferation. Nat. Commun.6, 8372.Smart, N.G., Apelqvist, A.A., Gu, X., Harmon, E.B., Topper, J.N., MacDonald,R.J., and Kim, S.K. (2006). Conditional expression of Smad7 in pancreatic betacells disrupts TGF-beta signaling and induces reversible diabetes mellitus.PLoS Biol. 4, e39.Stewart, A.F., Hussain, M.A., Garcı´a-Ocan˜ a, A., Vasavada, R.C., Bhushan, A.,Bernal-Mizrachi, E., and Kulkarni, R.N. (2015). Human b-cell proliferation andintracellular signaling: part 3. Diabetes 64, 1872–1885.Sui, L., Danzl, N., Campbell, S.R., Viola, R., Williams, D., Xing, Y., Wang, Y.,Phillips, N., Poffenberger, G., Johannesson, B., et al. (2018). b-cell replace-ment in mice using human type 1 diabetes nuclear transfer embryonic stemcells. Diabetes 67, 26–35.Tahtouh, T., Elkins, J.M., Soundararajan, M., Burgy, G., Durieu, E., Cochet, C.,Schmid, R.S., Lo, D.C., Delhommel, F., et al. (2012). Selectivity, cocrystalstructures, and neuroprotective properties of leucettines, a family of protein ki-nase inhibitors derived from the marine sponge alkaloid leucettamine B.J. Med. Chem. 55, 9312–9330.Talchai, C., Xuan, S., Lin, H.V., Sussel, L., and Accili, D. (2012). Pancreatic bcell dedifferentiation as a mechanism of diabetic bcell failure. Cell 150,1223–1234.Tiwari, S., Roel, C., Wills, R., Casinelli, G., Tanwir, M., Takane, K.K., andFiaschi-Taesch, N.M. (2015). Early and late G1/S cyclins and Cdks act comple-mentarily to enhance authentic human b-cell proliferation and expansion.Diabetes 64, 3485–3498.Trachtman, H., Fervenza, F.C., Gipson, D.S., Heering, P., Jayne, D.R., Peters,H., Rota, S., Remuzzi, G., Rump, L.C., Sellin, L.K., et al. (2011). A phase 1,single-dose study of fresolimumab, an anti-TGF-bantibody, in treatment-resistant primary focal segmental glomerulosclerosis. Kidney Int. 79,1236–1243.Wang, P., Alvarez-Perez, J.C., Felsenfeld, D.P., Liu, H., Sivendran, S., Bender,A., Kumar, A., Sanchez, R., Scott, D.K., Garcia-Ocan˜a, A., and Stewart, A.F.Cell Metabolism 29, 638–652, March 5, 2019 651 (2015a). A high-throughput chemical screen reveals that harmine-mediated in-hibition of DYRK1A increases human pancreatic beta cell replication. Nat.Med. 21, 383–388.Wang, P., Fiaschi-Taesch, N.M., Vasavada, R.C., Scott, D.K., Garcı´a-Ocan˜ a,A., and Stewart, A.F. (2015b). Diabetes mellitus–advances and challenges inhuman b-cell proliferation. Nat. Rev. Endocrinol. 11, 201–212.Wang, Y.J., Golson, M.L., Schug, J., Traum, D., Liu, C., Vivek, K., Dorrell, C.,Naji, A., Powers, A.C., Chang, K.M., et al. (2016). Single-cell mass cytometryanalysis of the human endocrine pancreas. Cell Metab. 24, 616–626.Wang, H., Bender, A., Wang, P., Karakose, E., Inabnet, W.B., Libutti, S.K.,Arnold, A., Lambertini, L., Stang, M., Chen, H., et al. (2017). Insights intobeta cell regeneration for diabetes via integration of molecular landscapes inhuman insulinomas. Nat. Commun. 8, 767.Xiao, X., Gaffar, I., Guo, P., Wiersch, J., Fischbach, S., Peirish, L., Song, Z., El-Gohary, Y., Prasadan, K., Shiota, C., and Gittes, G.K. (2014). M2 macrophag espromote beta-cell proliferation by up-regulation of SMAD7. Proc. Natl. Acad.Sci. USA 111, E1211–E1220.Xiao, X., Fischbach, S., Song, Z., Gaffar, I., Zimmerman, R., Wiersch, J.,Prasadan, K., Shiota, C., Guo, P., Ramachandran, S., et al. (2016). Transientsuppression of TGFbreceptor signaling facilitates human islet transplantation.Endocrinology 157, 1348–1356.Yanagita, M. (2012). Inhibitors/antagonists of TGF-bsystem in kidney fibrosis.Nephrol. Dial. Transplant. 27, 3686–3691.Yang, X., Karuturi, R.K., Sun, F., Aau, M., Yu, K., Shao, R., Miller, L.D., Tan,P.B., and Yu, Q. (2009). CDKN1C (p57) is a direct target of EZH2 and sup-pressed by multiple epigenetic mechanisms in breast cancer cells. PLoSOne 4, e5011.Zhou, J.X., Dhawan, S., Fu, H., Snyder, E., Bottino, R., Kundu, S., Kim, S.K.,and Bhushan, A. (2013). Combined modulation of polycomb and trithoraxgenes rejuvenates bcell replication. J. Clin. Invest. 123, 4849–4858.652 Cell Metabolism 29, 638–652, March 5, 2019 STAR+METHODSKEY RESOURCES TABLEREAGENT or RESOURCE SOURCE IDENTIFIERAntibodiesAntibodies for ImmunoblotsRabbit Monoclonal anti-SMAD 2/3 (D7G7) Cell Signaling Technology Cat#8685; RRID: AB_10889933Rabbit Monoclonal anti-p-SMAD3 (p423+p425) (D27F4) Abcam Cat#Ab52903 Lot:GR128879-28; RRID: AB_882596Rabbit Polyclonal anti-SMAD4 (B8) Santa Cruz Cat#Sc-7966 Lot: A2816; RRID: AB_627905Rabbit Polyclonal anti-SMAD1/5/9 Abcam Cat#ab66737 Lot:GR280688-13; RRID: AB_2192755Rabbit Polyclonal anti-GAPDH (FL-335) Santa Cruz Cat#Sc-25778 Lot:13015; RRID: AB_10167668Antibodies for ImmunohistochemistryRat Monoclonal anti-BrdU (ICR1) Abcam Cat#ab6326; RRID: AB_305426Rabbit Monoclonal anti-Ki67 (Sp6) Thermo Scientific Cat#RM-9106 s1; RRID: AB_149792Mouse Monoclonal anti-Ki67(MIB1), DAKO Cat# M7240 Lot: 20014345; RRID: AB_2142367Rabbit Polyclonal anti-p-Histone-3 Millipore Cat#06-570 Lot:GR273043-1; RRID: AB_310177Polyclonal Guinea Pig Anti-Insulin DAKO Cat#A0564; RRID: AB_100113624Mouse Monoclonal anti-p-gH2AX (3F2) Thermo Scientific Cat#MA1-2022: RRID: AB_559491Mouse Monoclonal anti-NKX6.1 University of Iowa Cat#F55A10-c; No RRIDRabbit Polyclonal anti-PDX1 Millipore Cat#07-696; RRID: AB_417404Rabbit Polyclonal anti-MAFA Abcam Cat#Ab26405; RRID: AB_776146Rabbit Monoclonal anti-Glucagon Abcam Cat#ab108426; RRID: AB_10887227Rabbit Polyclonal anti-Somatostatin Santa Cruz Cat#Sc-20999 Lot: F707; RRID: AB_2195927Rabbit Polyclonal anti-Pancreatic Polypeptide DAKO Cat#A0619 Lot:0111D; discontinued, No RRIDRabbit Monoclonal anti-CK19 Abcam Cat#Ab52625; RRID: AB_2281020Secondary AntibodySpecies-specific mouse Alexa Fluor 488 Life Technologies Cat#A-11029: RRID: AB_138404Rat Alexa Fluor 594 Life Technologies Cat#A-11007; RRID: AB_141374Rabbit Alexa Fluor 488 Life Technologies Cat#A11037; No RRIDGuinea pig Alexa Fluor 488 Life Technologies Cat#A-11073; RRID: AB_142081Antibodies for CHIPRabbit Monoclonal anti-anti-SMAD2/3 Cell Signaling Cat#8685; RRID: AB_10889933Goat Polycolonal anti-SMAD4 R D Systems Cat#AF2097; RRID: AB_355150Rabbit Polyclonal anti-KDM6A Abcam Cat#ab84190; RRID: AB_18611527Rabbit Polyclonal anti-MEN1 Bethyl Laboratories Cat#A300-105A; RRID: AB_2143306Bacterial and Virus StrainsBlock-it Adenoviral RNAi expression system Life Technologies K494100; No RRIDpAd/CMV/V5-DEST Gateway Vector Kit Lifetechnologies V49320; No RRIDpAd/BLOCK-iT-DEST RNAi Gateway Vector Lifetechnologies V49220: No RRIDSMAD6 plasmid DNA Harvard Plasmid LibraryBANK (https://plasmid.med.harvard.edu/PLASMID)HsCD00325924; No RRIDSMAD7 Plasmid DNA Harvard Plasmid LibraryBANK (https://plasmid.med.harvard.edu/PLASMID)HsCD00345789; No RRIDChemicals, Peptides, and Recombinant ProteinsINDY Tocris Biosciences Cat#4997 CAS 1169755-45-6BrdU substrate GE Healthcare Cat#RPN20Harmine Sigma Cat#286044 CAS 442-51-3Harmine.hydrochloride This paper CAS 343-27-1(Continued on next page)Cell Metabolism 29, 638–652.e1–e5, March 5, 2019 e1 CONTACT FOR REAGENT AND RESOURCE SHARINGRequests for reagents and resources should be directed to and will be fulfilled by the Lead Contact, Andrew F. Stewart (andrew.stewart@mssm.edu).EXPERIMENTAL MODEL AND SUBJECT DETAILSHuman Pancreatic Islet StudiesHIPPA-Compliant de-identified islets from 98 normal and six Type 2 diabetic adult cadaveric pancreas donors were obtained fromthe NIH/NIDDK-supported Integrated Islet Distribution Program (IIDP) (https://iidp.coh.org), from Dr. Tatsuya Kin at the University ofAlberta, or from Dr. Patrick MacDonald at the Alberta Diabetes Institute. In all cases, informed written consent was provided at theinstitutions where the organs were harvested. For the normal doors, the mean age was 43.1 y.o. (range 16-68), 67 were male and 31female, and the mean BMI was 30.5 (range 18.4-47.8). Sixty-six were Caucasian, 22 Hispanic/Latino, 6 Black, 3 Asian and 1 PacificContinuedREAGENT or RESOURCE SOURCE IDENTIFIERLeucettine-41 Adipogen Cat#AG-MR-C0023-M005CAS 112978-84-3LY364947 Selleckchem Cat#S2805Alk5 inhibitor II Cayman Chemical Cat#14794 CAS446859-33-2GW788388 Selleckchem Cat#S2750 CAS 452342-67-5A83-01 Tocris Cat#2939 CAS 909910-43-6SB431542 Selleckchem Cat#S1067 CAS 301836-41-9K02288 Selleckchem Cat#S7359 CAS 1431985-92-0LDN193189 Selleckchem Cat#CA2618 CAS 1062368-24-4Experimental Models: Cell LinesHuman: HUES 8 hESC line (NIH approval numberNIHhESC-09-0021)HSCI iPS Core hES Cell Line: HUES-8OligonucleotidesPrimers for CHIPCDKN1A_1 Forward ATGATCTCAGCTCACTGCAA This paper N/ACDKN1A_1 Reverse ACAGGGTCAGGAGTTTTGAG This paper N/ACDKN1A_2 Forward GGCTGCCTCTGCTCAATAATG This paper N/ACDKN1A_2 Reverse ACAGGGTCAGGAGTTTTGAG This paper N/ACDKN1A_3 Forward CTCCCCAAAGTAAAC AGAC This paper N/ACDKN1A_3 Reverse CCAGCCCTTTGGATGGTTTG This paper N/ACDKN1A_4 Forward CTGCTGGAACTCGGCCAGGCTCAG This paper N/ACDKN1A_4 Reverse TGAGCTGCGCCAGCTGAGGTGTGA This paper N/ACDKN1A_5 Forward CTAAAACAA GGGTTTGCG This paper N/ACDKN1A_5 Reverse CTAGATCCTAGTCCTGTCTTGAAC This paper N/ACDKN1A_6 Forward ACTTGTCCCTAGGAAAATCC Koinuma et al., 2009 N/ACDKN1A_6 Reverse GAAAACGGAGAGTGAGTTTG N/AshRNA against SMAD2 target sequence This paper N/AGCTGTAATCTGAAGATCTTCAshRNA against SMAD3 target sequence This paper N/AGCAACCTGAAGATCTTCAACAshRNA against SMAD4 target sequence This paper N/AGGAATTGATCTCTCAGGATTAshRNA against CDKN1A target sequence This paper N/ACGCTCTACATCTTCTGCCTTAshRNA against CDKN1C target sequence This paper N/AATTCTGCACGAGAAGGTACACe2 Cell Metabolism 29, 638–652.e1–e5, March 5, 2019 Islander. The mean cold ischemia time was 509 min (range 210-1340). Purity ranged from 55%–99%. Among the Type 2 diabetesdonors, the mean age was 53.8 y.o. (range 46-62), four were male and two were female, the mean BMI was 36.2 (range32.5-42.8), and three were Caucasian and three were Hispanic. The mean HbA1c (±SEM) was 8.8 (±3.9), and three had had T2Dfor 0-5 years while the other three had had T2D for 6-10 years. Five of the six were on diabetes medications (1 on insulin, 4 onmetformin, and 1 on an unknown diabetes medication). The causes of death were stroke (4), head trauma (1) and anoxia (1).Mean cold ischemia time was 367 min (range 352-384 min). Islet purity ranged from 55%–85%. Depending on the experiments per-formed, islets were used either as intact islets, or were first dispersed with Accutase (Sigma, St. Louis, MO) onto coverslips asdescribed in the Figure Legends.Mouse StudiesAll studies were approved in advance by, and performed in compliance with, the Icahn School of Medicine at Mount Sinai InstitutionalAnimal Care and Use Committee.Normal Mouse Pancreas StudiesMale C57BL/6N mice (12-week-old) received vehicle (saline), 10 mg/kg harmine HCl, 30 mg/kg GW788388 or the combination ofharmine and GW788388 by intraperitoneal injection daily for 7 days. Mice were sacrificed on day 7, pancreata harvested, fixed in10% neutral buffered formalin, paraffin embedded and sectioned. Sections were stained for Ki67 and insulin as previously reported(Wang et al., 2015a). A minimum of 2,000 beta cells per pancreas was counted.Mouse Partial Pancreatectomy (PPX) StudiesThese studies were performed exactly as described previously (Wang et al., 2015a), with one exception: pancreas remnants wereharvested at one week, rather than two weeks, following PPX. Briefly, 12 week old C57BL/6N mice underwent a sham or real60% PPX. Seven days later, they were euthanized and the pancreas remnant harvested, weighed, fixed, sectioned, immunolabeledfor insulin, beta cell area counted, and beta cell mass determined, all as described (Wang et al., 2015a).NOD-SCID Mouse StudiesMale NOD-SCID mice (12 week old) were transplanted with human cadaveric islets in the left renal subcapsular space as describedpreviously (Wang et al., 2015a). On postoperative day 7, they were randomized to receive vehicle (saline), 10 mg/kg harmine HCl,30 mg/kg GW788388 or the combination of harmine and GW788388 by intraperitoneal injection daily for seven days. The renal graftsthen were harvested, fixed, sectioned, immunolabelled for insulin and Ki67, and counted as described above, and as reported (Wanget al., 2015a). Five human islet donors were used in each of five sets of four NOD-SCID mice. A minimum of 2000 human beta cellswere counted per graft. Investigators were blinded as to group assignments in all studies.METHOD DETAILSAdenoviruses and TransductionAdenoviruses were prepared as described previously (Cozar-Castellano et al., 2004; Fiaschi-Taesch et al., 2009, 2013a, 2013b;Wang et al., 2015a, 2017). Unless otherwise described, all transductions were performed using 150 moi for two hours, and studiesperformed 96 hours later. The sequence and validation of the Ad.DYRK1A and Ad.shDYRK1A have been reported previously (Diriceet al., 2016; Wang et al., 2015a). Adenoviruses encoding human SMAD6 or SMAD7 were prepared using cDNAs encoding SMAD6and SMAD7 obtained from Harvard PlasmID Database (https://plasmid.med.harvard.edu/). Adenoviruses employed for silencingSMADs 2,3 and 4 employed the DNA sequences in the Key Resources Table.Quantitative PCRRNA was isolated and quantitative RT-PCR was performed as described previously (Wang et al., 2015a). Gene expression indispersed islets was analyzed by real-time PCR performed on an ABI 7500 System. Primers were as reported previously (Wanget al., 2015a) an in the Key Resources Table.RNA sequencingRNA from whole human islets (Tables S1 and S2) was prepared immediately using the RNeasy Micro kit (QIAGEN). Beta cell RNAyields were 300-500 ng from each FACS run, and RNA integrity numbers were between 9.5 and 10.0. PolyA+mRNA from sortedbeta cells was purified with oligo dT magnetic beads. The polyA+RNA from beta cells was then fragmented in the presence of divalentcations at 94C. The fragmented RNA was converted into double stranded cDNA. After polishing the ends of the cDNA, the 30endswere adenylated. Finally, Illumina-supplied universal adapters were ligated to the cDNA fragments. The adaptor ligated DNA was sizeselected to get an average of 250 bp insert size using AmpPure beads, and amplified by 15 cycle PCR. The PCR DNA was thenpurified using AmpPure beads to get the final seq library ready for sequencing. The insert size and DNA concentration of the seqlibrary was determined on Agilent Bioanalyzer and Qubit, respectively. A pool of 10 barcoded RNA seq libraries was layered ontwo of the eight lanes of the Illumina flow cell at appropriate concentration and bridge amplified to yield 25- 35 million raw clusters.The DNA reads on the flow cell were then sequenced on HiSeq 2000 using a 100 bp paired end recipe. Results are expressed asmillions of counts (reads) per million bases (CPM).Cell Metabolism 29, 638–652.e1–e5, March 5, 2019 e3 ImmunocytochemistryImmunocytochemistry was performed on 4% paraformaldehyde fixed (15 min), Accutase-dispersed human islets plated on cover-slips as described (Gaarenstroom and Hill, 2014; Micallef et al., 2012; Pagliuca et al., 2014; Tahtouh et al., 2012; Wang et al., 2015a,2015b). Primary antisera are shown in the Key Resources Table. TUNEL labeling was performed as described (Gaarenstroom andHill, 2014; Micallef et al., 2012; Pagliuca et al., 2014; Tahtouh et al., 2012; Wang et al., 2015a, 2015b).ImmunoblottingImmunoblots were performed on whole human islets as described in detail previously (Cozar-Castellano et al., 2004; Fiaschi-Taeschet al., 2009, 2013a, 2013b; Wang et al., 2015a).Glucose-Stimulated Insulin SecretionGSIS was performed as described previously (Cozar-Castellano et al., 2004; Fiaschi-Taesch et al., 2009, 2013a, 2013b; Wang et al.,2015a). Briefly, whole human islets were cultured in low glucose (2.8mM) or high glucose (16.8 mM) for 30 min, and media harvestedand assayed for insulin (Mercodia). Results are expressed as fold change in media insulin concentration in high glucose as comparedto the low glucose concentration.Proliferation in HUES8-Derived Human Beta CellsStem cell-derived beta cell proliferation assays were performed using three separate batches of cryopreserved cells. Differentiationof Harvard University embryonic stem 8 (HUES8) cells into beta cells was carried out as previously described (Millman et al., 2016;Pagliuca et al., 2014). Briefly, cryobanked SC-islet cells were thawed and aggregated in Stage 6 (S6) media (DMEM/F12 plus1% HSA) for 8 11 days in suspension culture. Clusters were then dissociated using Accutase (Innovative Cell Technologies, catalog#: AT-104) for 10 min and plated onto Matrigel- (Corning, catalog #: 354277) coated 96 well plates at a density of 1 3105cells/well inS6 media with 10 uM Y-27632. Following 24 hr of culture, compound treatment was initiated and lasted for four days with replenish-ment every other day. Cells were fixed with 4% paraformaldehyde for 15 min then stained overnight for insulin (Dako, A0564) and Ki67(Thermo Scientific, RM-9106 s1) followed by fluorescent secondary antibodies (Thermo), anti-rabbit Alexa 594 and anti-guinea pigAlexa 488 and Hoescht (Thermo, H3569) staining. Beta cell proliferation (%insulin+/Ki67+) was quantified using a MultiwavelengthCell Scoring algorithm on the ImageXpress Micro 4 High-Content Imaging System (Molecular Devices) (Shen et al., 2015).Expansion and Differentiation of Mel1-Derived Beta Cells: Stem cell line and cultureThe Mel1 hESC line (Micallef et al., 2012) used in this manuscript is an NIH approved line (registry # 0139). hESC are grown on platescoated with primary mouse embryonic fibroblasts or MEFs (GlobalStem, CF-1 MEF IRR) and using human ES medium containingDMEM (GIBCO, 10569), 10% FBS (GE Healthcare, SH30088.03HI), 1% GlutaMAX (GIBCO, 35050061) and 1% Pen-Strep (ThermoFisher Scientific, 15070-063). Cells are dissociated every 4-5 days using TrypLE Express (Life Technology, 12605036) for passaging.After dissociation, cells were suspended in human ES medium containing 10 mM ROCK inhibitor Y27632 (Selleckchem, S1049).Differentiation of Mel1 Cells into Pancreatic IsletsCells are grown to 80%–90% confluence, dissociated and suspended in mTeSR medium (STEMCELL Technology, 05850) with10 mM ROCK inhibitor Y27632 (Selleckchem, S1049) and plated in a 1:1 ratio into Matrigel-coated (Fisher Scientific, 354277) wellsfor differentiation as previously described (Sui et al., 2018). The initial stages of differentiation were conducted in planar culture(d0-d11). For definitive endoderm stage (d1-d3) cells were cultured using STEMdiffTM Definitive Endoderm Differentiation Kit(StemCell Technologies, 05110). For primitive gut stage (d4-d6), cells were cultured in RPMI containing GlutaMAX (Life Technology,61870-127), 1% (v/v) Penicillin-Streptomycin (PS) (Thermo Fisher Scientific, 15070-063), 1% (v/v) B27 Serum-Free Supplement (50x)(Life Technology, 17504044) and 50 ng/mL FGF7 (R D System, 251-KG). For posterior foregut stage (d7-d8), cells were cultured inDMEM containing GlutaMax, 1% (v/v) PS, 1% (v/v) B27, 0.25 mM KAAD-Cyclopamine (Stemgent, 04-0028), 2 mM Retinoic acid(Stemgent, 04-0021) and 0.25 mM LDN193189 (Stemgent, 04-0074). For pancreatic progenitor stage (d9-d11), cells were culturedin DMEM containing GlutaMax, 1% (v/v) PS, 1% (v/v) B27 and 50 ng/mL EGF (R D System, 236-EG). Cells were then dissociatedusing TrypLE Express (Life Technology, 12605036) and seeded into low-attachment 96 well-plates (Corning, 7007) (1 well of 6well-plate to 60 wells of 96-well-plate) for clustering step to form aggregates or clusters of endocrine cells in DMEM containingGlutaMax, 1% (v/v) PS, 1% (v/v) B27, 0.25 mM Cyclopamine, 1 mM thyroid hormone (T3) (Sigma, T6397), 10 mM Alk5i, 10 mM Zincsulfate (Sigma-Aldrich, Z4750) and 10 mg/mL Heparin (Sigma-Aldrich, H3149) for 2 days (d12-d13). For pancreatic endocrine stage(d14-20) cells were cultured using DMEM containing GlutaMax, 1% (v/v) PS, 1% (v/v) B27, 100 nM LDN, 1 mM T3, 10 mM Alk5i, 10 mMZinc sulfate, 10 mg/mL Heparin and 100 nM gamma-secretase inhibitor (DBZ) (EMD Millipore, 565789). For mature pancreatic endo-crine stage (d21-d27) cells were cultured using DMEM containing GlutaMax, 1% (v/v) PS, 1% (v/v) B27, 1 mM T3, 10 mM Alk5i, 10 mMZinc sulfate, 10 mg/mL Heparin, 1 mM N-acetyl cysteine (N-Cys) (Sigma-Aldrich, A9165-5G), 10 mM Trolox (EMD Millipore, 648471-500MG) and 2 mM R428 (Tyrosine kinase receptor AXL inhibitor) (ApexBio, A8329). From d1 to d11 media was changed every day andfrom d12 to d27 media was changed every other day. All differentiations were done for 27 to 30 days. At Day 21, beta cell clusterswere dissociated with trypsin and seeded at the exact same cell number (300-500,000 cells per well) into chambers on poly-D-lysine/laminin-coated slides and treated with either DMSO or the harmine-TGFbinhibitor combination.e4 Cell Metabolism 29, 638–652.e1–e5, March 5, 2019 Flow Cytometry to Quantify Human Beta CellsHuman islets (250-300 IEQ) or stem cell-derived beta cells (300-500,000) were dispersed using Accutase (MT25058CI, Fisher Scien-tific) (for human islets) or trypsin (for hESC-derived beta cells) and plated on laminin/poly-D-lysine coated chamber slides (BD354688,VWR Scientific). For human islets, beta cells were labeled with an adenovirus as described previously (Wang et al., 2017). Briefly,human islet cells were dispersed to single cells in eigth-well chambers and transduced for two hours in RPMI1640 medium withoutfetal bovine serum (FBS) with 150 moi of an adenovirus expressing the bright green fluorescent protein, ZsGreen (Clontech, MountainView CA), under control of the rat insulin-1 promoter (RIP1) and a mini-CMV enhancer (Wang et al., 2017). The RIP1-miniCMV pro-moter included 177 bases of the hCMV IE-1 promoter ClaI-SpeI fragment ligated to 438 bases of the RIP1 promoter. The beta cellfraction was confirmed to be 92% pure by immunolabeling of sorted cells with insulin, by qRT-PCR and by RNaseq (Figure S7)(Wang et al., 2017). Following transduction with the Ad.RIP-ZsGreen adenovirus for two hours, 300 mL of RPMI1640 medium con-taining 10% FBS was added to terminate adenovirus infection, and cells were allowed to express ZsGreen for 24 hours. At this point,fresh medium containing DMSO or harmine 10mM, Ly364947 3mM or the harmine-LY combination was added for another four days.Human Mel1-ES cell-derived beta cells were labeled with endogenous GFP (Sui et al., 2018).For flow cytometric human beta cell quantification, following four days (for human islet cells) or seven days (for hESC-derived betacells) of drug treatment (DMSO or harmine + LY364947), cells were harvested by gentle Accutase (for human beta cells) or trypsin (forhESC-dervied beta cells) dissociation and 50,000 fluorescent beads (ACURFP-50-10, Spherotech) were added, serving as an inter-nal recovery standard and FACS counting reference. DAPI (D3571, Life Technologies) was used as a dead/live cell marker. Dispersedcells were loaded onto an Aria II cell sorter, and live ZsGreen+(from human islets) or GFP+(from hESC) cells were counted until10,000 beads had been counted from each the vehicle- and the harmine-LY364947-treated wells. Results are expressed as absolutenumbers of ZsGreen+or GFP+beta cells, corrected to the 50,000 original internal bead standard. The beta cell fraction was confirmedto be 92% pure by immunolabeling of sorted cells with insulin, by qRT-PCR and by RNaseq (Wang et al., 2017).Chromatin Immunoprecipitation (ChIP) AssaysChIP was performed using the EZ-ChIP Kit (#Magna0001, Millipore) according to manufacturer’s protocol as described previously(Wang et al., 2017). Whole human cadaveric islets were dispersed as described previously. A minimum of three separate islet prep-arations were used for each figure shown. 2x106cells were collected per experiment for each SMAD2/3, SMAD4, KDM6A and MEN1immunoprecipitation. Immunoprecipitated DNA was quantified using ABI 7500 real-time quantitative PCR detection system (LifeTechnologies). Data are presented as binding signals calculated by normalizing the ChIP signals relative to input controls and sub-sequently subtracting the IgG value from the respective antibody. The resulting values below zero indicated no binding and depictedas ‘zero’ in ChIP plots. Error bars indicate mean ± SEM. The primer sets for CDKN1A and CDKN1C were described previously(Koinuma et al., 2009; Wang et al., 2017; Yang et al., 2009). The antibodies and the primer sequences used are described in theKey Resources Table.QUANTIFICATION AND STATISTICAL ANALYSISStatisticsStatistics were performed using Student’s two-tailed paired t test (for paired samples) or by One-Way Analysis of Variance forrepeated-measures for multiple comparisons, as described in the Figure Legends. P values less than 0.05 were considered to besignificant.DATA AND SOFTWARE AVAILIBILITYRNaseq data re available in Tables S1 and S2.Cell Metabolism 29, 638–652.e1–e5, March 5, 2019 e5Citations (58)References (74)... In a second, we used a human ES cell line in which GFP has been knocked-into the one allele of the insulin locus. These maneuvers enabled beta cell labeling and quantification by flow cytometry (28,29). In each case, as described below, drug treatment led to a clear, statistically and quantitatively significant increase in the number of human beta cells as will be discussed in detail below. ...... The first report of a DYRK1A inhibitor able to induce beta cell proliferation was reported in 2012 by Annes et al, who demonstrated that 5-iodotubericidin (5-IT) is able to induce rodent and porcine beta cells to replicate, an effect initially attributed to the ability of 5-IT to inhibit adenosine kinase (47). In 2015 through 2020, multiple groups including Laffite et al., Wagner et al., Annes et al., and ourselves showed that multiple DYRK1A inhibitors -harmine, INDY, leucettine-41, GNF4877, GNF2133, CC-401, OTS-167, and 2-2c -are able to induce human beta cells to replicate, as assessed by Ki67, BrdU, EdU, PHH3 immunolabeling, at rates of 2-3% (28,29,(47)(48)(49)(50)(51)(52)(53)(54)(55). Importantly, human beta cell proliferation can be reproduced by directly silencing DYRK1A gene expression in human islets (28,29,(48)(49)(50)(51). Conversely, proliferation in response to DYRK1A inhibitors can be blocked by overexpression of DYRK1A in human islets (28,29,48). ...... In 2015 through 2020, multiple groups including Laffite et al., Wagner et al., Annes et al., and ourselves showed that multiple DYRK1A inhibitors -harmine, INDY, leucettine-41, GNF4877, GNF2133, CC-401, OTS-167, and 2-2c -are able to induce human beta cells to replicate, as assessed by Ki67, BrdU, EdU, PHH3 immunolabeling, at rates of 2-3% (28,29,(47)(48)(49)(50)(51)(52)(53)(54)(55). Importantly, human beta cell proliferation can be reproduced by directly silencing DYRK1A gene expression in human islets (28,29,(48)(49)(50)(51). Conversely, proliferation in response to DYRK1A inhibitors can be blocked by overexpression of DYRK1A in human islets (28,29,48). ...Human Beta Cell Regenerative Drug Therapy for Diabetes: Past Achievements and Future ChallengesArticleFull-text availableJul 2021Peng WangEsra KarakoseLauryn CholevaAndrew F. StewartA quantitative deficiency of normally functioning insulin-producing pancreatic beta cells is a major contributor to all common forms of diabetes. This is the underlying premise for attempts to replace beta cells in people with diabetes by pancreas transplantation, pancreatic islet transplantation, and transplantation of beta cells or pancreatic islets derived from human stem cells. While progress is rapid and impressive in the beta cell replacement field, these approaches are expensive, and for transplant approaches, limited by donor organ availability. For these reasons, beta cell replacement will not likely become available to the hundreds of millions of people around the world with diabetes. Since the large majority of people with diabetes have some residual beta cells in their pancreata, an alternate approach to reversing diabetes would be developing pharmacologic approaches to induce these residual beta cells to regenerate and expand in a way that also permits normal function. Unfortunately, despite the broad availability of multiple classes of diabetes drugs in the current diabetes armamentarium, none has the ability to induce regeneration or expansion of human beta cells. Development of such drugs would be transformative for diabetes care around the world. This picture has begun to change. Over the past half-decade, a novel class of beta cell regenerative small molecules has emerged: the DYRK1A inhibitors. Their emergence has tremendous potential, but many areas of uncertainty and challenge remain. In this review, we summarize the accomplishments in the world of beta cell regenerative drug development and summarize areas in which most experts would agree. We also outline and summarize areas of disagreement or lack of unanimity, of controversy in the field, of obstacles to beta cell regeneration, and of challenges that will need to be overcome in order to establish human beta cell regenerative drug therapeutics as a clinically viable class of diabetes drugs.ViewShow abstract... Proliferative effects of harmine, glucose, and HB-EGF in dispersed human islets as assessed by immunocytochemistry. As the majority of previous studies examined the effects of mitogens on human β-cell proliferation in dispersed islet cultures [17][18][19]21,[24][25][26][27] , we began by attempting to reproduce these findings. Following recovery, human islets were dispersed, plated and exposed to harmine (10 μM), high glucose (16.7 mM) or HB-EGF (100 ng/ml) for 3 days in the presence of the proliferation marker 5-ethynyl-2′-deoxyuridine (EdU). ...... In general, the fraction of EdU + /Nkx6.1 + cells was lower than the corresponding EdU + / CPEP + cells. This is reminiscent of a study by Aamodt et al. 31 in dispersed human islets, who scored only β cells that were both insulin + and pancreatic and duodenal homeobox-1 (Pdx-1) + and described a considerably lower level of β-cell proliferation in response to harmine and glucose compared to studies where all insulin + (or CPEP + ) cells were scored [17][18][19]21,[24][25][26][27]32 . This phenomenon may be explained in part by the fact that actively proliferating β-cells express lower levels of differentiation markers 33 , which would decrease the sensitivity of detection of double labeling. ...... Whether the potency of harmine differs between cell types, however, is not known as the mitogenic effects of harmine were only assessed at 10 μM. Nevertheless, these data are consistent with previous studies demonstrating a potent mitogenic effect of harmine on human β-cell replication both in vitro and in vivo 21,26 . Furthermore, the increase in proliferation of non-β cells in response to harmine is expected given the ubiquitous nature of DYRK1A signaling, and is consistent with several studies. ...Pronounced proliferation of non-beta cells in response to beta-cell mitogens in isolated human islets of LangerhansArticleFull-text availableMay 2021 Hasna Maachi Julien GhislainCaroline Tremblay Vincent PoitoutThe potential to treat diabetes by increasing beta-cell mass is driving a major effort to identify beta-cell mitogens. Demonstration of mitogen activity in human beta cells is frequently performed in ex vivo assays. However, reported disparities in the efficacy of beta-cell mitogens led us to investigate the sources of this variability. We studied 35 male (23) and female (12) human islet batches covering a range of donor ages and BMI. Islets were kept intact or dispersed into single cells and cultured in the presence of harmine, glucose, or heparin-binding epidermal growth factor-like growth factor (HB-EGF), and subsequently analyzed by immunohistochemistry or flow cytometry. Proliferating cells were identified by double labeling with EdU and Ki67 and glucagon, c-peptide or Nkx6.1, and cytokeratin-19 to respectively label alpha, beta, and ductal cells. Harmine and HB-EGF stimulated human beta-cell proliferation, but the effect of glucose was dependent on the assay and the donor. Harmine potently stimulated alpha-cell proliferation and both harmine and HB-EGF increased proliferation of insulin- and glucagon-negative cells, including cytokeratin 19-positive cells. Given the abundance of non-beta cells in human islet preparations, our results suggest that assessment of beta-cell mitogens requires complementary approaches and rigorous identification of cell identity using multiple markers.ViewShow abstract... This approach could involve inducing the reprogramming of other mature cell types to β cells, differentiation of progenitor cells to β cells or proliferation of β cells. Treating β cells with chemicals to increase their proliferation has only recently shown promise for human β cells [3][4][5][6] . β cell proliferation is one of the main mechanisms expanding β cell mass early in life [7][8][9] . ...... All experimental procedures complied with the ethical regulations of the islet-isolating centres and participating universities. Information about the donors are displayed in Supplementary Table 5. Islets were first dissociated with Accutase (A6964, Sigma-Aldrich), transferred onto coverslips, allowed to attach for 2 h and then treated with complete medium containing 11 mM glucose and the corresponding compounds 3,4 . ...... Immunostaining of human islet cells. Immunocytochemistry was performed on 4% paraformaldehyde-fixed (15 min), Accutase-dissociated human islets plated on coverslips as described previously 3,4 . The primary antisera used were anti-insulin (1:500, A0564, Dako) and anti-Ki67 (1:300, RM-9106-s1, Thermo Fisher Scientific). ...In vivo screen identifies a SIK inhibitor that induces β cell proliferation through a transient UPRArticleFull-text availableMay 2021 Jeremie Charbord Ren Lipeng Rohit Bhardwaj Sharma Olov AnderssonIt is known that β cell proliferation expands the β cell mass during development and under certain hyperglycemic conditions in the adult, a process that may be used for β cell regeneration in diabetes. Here, through a new high-throughput screen using a luminescence ubiquitination-based cell cycle indicator (LUCCI) in zebrafish, we identify HG-9-91-01 as a driver of proliferation and confirm this effect in mouse and human β cells. HG-9-91-01 is an inhibitor of salt-inducible kinases (SIKs), and overexpression of Sik1 specifically in β cells blocks the effect of HG-9-91-01 on β cell proliferation. Single-cell transcriptomic analyses of mouse β cells demonstrate that HG-9-91-01 induces a wave of activating transcription factor (ATF)6-dependent unfolded protein response (UPR) before cell cycle entry. Importantly, the UPR wave is not associated with an increase in insulin expression. Additional mechanistic studies indicate that HG-9-91-01 induces multiple signalling effectors downstream of SIK inhibition, including CRTC1, CRTC2, ATF6, IRE1 and mTOR, which integrate to collectively drive β cell proliferation.ViewShow abstract... Therefore, restoring physiological numbers of endogenous β-cells, improving β-cell functionality, or generating insulinproducing β-like cells derived from stem cells for transplantation are promising strategies to resolve diabetes in patients. While the identification of factors able to stimulate β-cell proliferation [3][4][5][6][7][8][9][10][11] and the improvement of differentiation protocols to generate functional β-like cells [12][13][14][15][16][17] continue to evolve, gaining insights into dynamic changes in the global transcriptome of βcells, especially following manipulation in an in vivo environment (e.g., in transplanted islets in humanized mouse models) is worth exploring. ...... To reveal the transcriptomic signature of frozen engrafted human islets, we undertook snRNA-seq experiments as depicted in Fig. 4A. We used the immunodeficient NSG mouse model which is a widely utilized in vivo model for βcell regeneration studies [6,8,10,65]. Human islets (1000 IEQs) obtained from 4 different donors were transplanted individually under the kidney capsule of 8-to-12-week-old male mice and followed up for 4 weeks. ...Using single-nucleus RNA-sequencing to interrogate transcriptomic profiles of archived human pancreatic isletsArticleFull-text availableAug 2021 Giorgio Basile Sevim Kahraman Ercument Dirice Rohit KulkarniBackgroundHuman pancreatic islets are a central focus of research in metabolic studies. Transcriptomics is frequently used to interrogate alterations in cultured human islet cells using single-cell RNA-sequencing (scRNA-seq). We introduce single-nucleus RNA-sequencing (snRNA-seq) as an alternative approach for investigating transplanted human islets.MethodsThe Nuclei EZ protocol was used to obtain nuclear preparations from fresh and frozen human islet cells. Such preparations were first used to generate snRNA-seq datasets and compared to scRNA-seq output obtained from cells from the same donor. Finally, we employed snRNA-seq to obtain the transcriptomic profile of archived human islets engrafted in immunodeficient animals.ResultsWe observed virtually complete concordance in identifying cell types and gene proportions as well as a strong association of global and islet cell type gene signatures between scRNA-seq and snRNA-seq applied to fresh and frozen cultured or transplanted human islet samples.ConclusionsWe propose snRNA-seq as a reliable strategy to probe transcriptomic profiles of freshly harvested or frozen sources of transplanted human islet cells especially when scRNA-seq is not ideal.ViewShow abstract... Previous research also revealed combined inhibition of DYRK1A and TGF-β signaling generates further synergistic increases in β-cell proliferation. 10 DMB treatment led to a reduction in SMAD3 phosphorylation and a concomitant increase in SMAD3 abundance. Furthermore, PDX1 expression in INS-1 cells was increased, while FOXO1 expression was reduced after DMB treatment ( Figure 2F). ...A natural DYRK1A inhibitor as a potential stimulator for β‐cell proliferation in diabetesArticleFull-text availableJul 2021Mengzhu ZhengQingzhe ZhangChengliang ZhangLixia ChenView... A STEM CELL MODEL OF HNF1A DEFICIENCY 3 Stem cell-derived β-cells provide a useful model system, and have been used to study β-cell development in humans (12,13) and to recapitulate disease phenotypes (14,15). Differentiation of pluripotent stem cells to pancreatic endocrine cells can be achieved by a multistep protocol resulting in islet-like clusters containing all endocrine cell types (16)(17)(18). ...HNF1A deficiency causes reduced calcium levels, accumulation of abnormal insulin granules and uncoupled insulin to C-peptide secretion in a stem cell model of MODY3PreprintFull-text availableMay 2021Bryan J. GonzálezHaoquan ZhaoJacqueline NiuDieter EgliMutations in HNF1A cause Maturity Onset Diabetes of the Young type 3 (MODY3), the most prevalent form of monogenic diabetes. Using stem cell-derived pancreatic endocrine cells from human embryonic stem cells (hESCs) with induced hypomorphic mutations in HNF1A, we show that HNF1A orchestrates a transcriptional program required for calcium-dependent insulin secretion. HNF1A-deficient β-cells display a reduction in CACNA1A and intracellular calcium levels, as well as impaired insulin granule exocytosis in association with SYT13 down-regulation. Knockout of CACNA1A and SYT13 reproduce the relevant phenotypes. Retention of insulin is associated with accumulation of enlarged secretory granules, and altered stoichiometry of secreted insulin to C-peptide. Glibenclamide, a sulfonylurea drug used in the treatment of MODY3 patients, increases intracellular calcium, and thereby restores C-peptide and insulin secretion to a normal ratio. While insulin secretion defects are constitutive in cells with complete HNF1A loss of function, β-cells from patients with heterozygous hypomorphic HNF1A mutations are initially normal, but lose the ability to secrete insulin and acquire abnormal stoichiometric secretion ratios, while gene corrected cells remain normal. Our studies provide the molecular basis for the treatment of MODY3 with sulfonylureas, and demonstrate promise for the use of cell therapies for MODY3.ViewShow abstract... 116,117 The most critical regulatory pathway of BMP signaling depends on the phosphorylation of Smad proteins. [118][119][120][121] In addition, BMP signaling also interferes with multiple signaling pathways, including MAPK/PI3K/Akt, Wnt, hedgehog, and notch, and participates in the regulation of various cytokines, such as the IL, INF-γ, and TNF-α. Due to the wide distribution and multiple functions of BMPs, disorder of BMPs may lead to developmental defects or diseases [122][123][124] (Fig. 2a). ...Endocrine role of bone in the regulation of energy metabolismArticleFull-text availableMay 2021Ruoyu Zhou Qiaoyue GuoYe XiaoXianghang LuosBone mainly functions as a supportive framework for the whole body and is the major regulator of calcium homeostasis and hematopoietic function. Recently, an increasing number of studies have characterized the significance of bone as an endocrine organ, suggesting that bone-derived factors regulate local bone metabolism and metabolic functions. In addition, these factors can regulate global energy homeostasis by altering insulin sensitivity, feeding behavior, and adipocyte commitment. These findings may provide a new pathological mechanism for related metabolic diseases or be used in the diagnosis, treatment, and prevention of metabolic diseases such as osteoporosis, obesity, and diabetes mellitus. In this review, we summarize the regulatory effect of bone and bone-derived factors on energy metabolism and discuss directions for future research.ViewShow abstractEngineering islets from stem cells for advanced therapies of diabetesArticleAug 2021NAT REV DRUG DISCOVJohanna Siehler Anna BlöchingerMatthias MeierHeiko LickertDiabetes mellitus is a metabolic disorder that affects more than 460 million people worldwide. Type 1 diabetes (T1D) is caused by autoimmune destruction of β-cells, whereas type 2 diabetes (T2D) is caused by a hostile metabolic environment that leads to β-cell exhaustion and dysfunction. Currently, first-line medications treat the symptomatic insulin resistance and hyperglycaemia, but do not prevent the progressive decline of β-cell mass and function. Thus, advanced therapies need to be developed that either protect or regenerate endogenous β-cell mass early in disease progression or replace lost β-cells with stem cell-derived β-like cells or engineered islet-like clusters. In this Review, we discuss the state of the art of stem cell differentiation and islet engineering, reflect on current and future challenges in the area and highlight the potential for cell replacement therapies, disease modelling and drug development using these cells. These efforts in stem cell and regenerative medicine will lay the foundations for future biomedical breakthroughs and potentially curative treatments for diabetes. Diabetes is a substantial and increasing health concern. In this Review, Lickert and colleagues discuss the progress made in developing insulin-producing islets using in vitro methods, including which aspects need to be improved in order to use these islets as transplants. Using these islets in laboratory settings could further our understanding of pancreatic function and the mechanisms underlying diabetes.ViewShow abstractβ-Cell pre-miR-21 Induces Dysfunction and Loss of Cellular Identity by Targeting Transforming Growth Factor Beta 2 (Tgfb2) and Smad Family Member 2 (Smad2) mRNAsArticleJul 2021Sara IbrahimMacey JohnsonClarissa Hernandez Stephens Emily Kristen SimsObjectiveβ-cell microRNA-21 (miR-21) is increased by islet inflammatory stress and decreases glucose stimulated insulin secretion (GSIS). Thus, we sought to define the effects of miR-21 on β-cell function using in vitro and in vivo systems.MethodsWe developed a tetracycline-on system of pre-miR-21 induction in clonal β-cells and human islets, as well as transgenic zebrafish and mouse models of β-cell specific pre-miR-21 overexpression.Resultsβ-cell miR-21 induction markedly reduced GSIS and led to reductions in transcription factors associated with β-cell identity and increases in markers of dedifferentiation, leading us to hypothesize that miR-21 induces β-cell dysfunction via loss of cell identity. In silico analysis identified Transforming Growth Factor Beta 2 (Tgfb2) and Smad Family Member 2 (Smad2) mRNAs as predicted miR-21 targets associated with maintenance of β-cell identity. Tgfb2 and Smad2 were confirmed as direct miR-21 targets via RT-PCR, immunoblot, pulldown and luciferase assays. In vivo zebrafish and mouse models exhibited glucose intolerance and decreased peak GSIS, decreased expression of β-cell identity markers, increased insulin and glucagon co-staining cells, and reduced Tgfb2 and Smad2 expression.ConclusionsThese findings implicate miR-21-mediated reduction of mRNAs specifying β-cell identity as a contributor to β-cell dysfunction via loss of cellular differentiation.ViewShow abstractDual-Specificity, Tyrosine Phosphorylation-Regulated Kinases (DYRKs) and cdc2-Like Kinases (CLKs) in Human Disease, an OverviewArticleFull-text availableJun 2021INT J MOL SCI Mattias Lindberg Laurent MeijerDual-specificity tyrosine phosphorylation-regulated kinases (DYRK1A, 1B, 2-4) and cdc2-like kinases (CLK1-4) belong to the CMGC group of serine/threonine kinases. These protein kinases are involved in multiple cellular functions, including intracellular signaling, mRNA splicing, chromatin transcription, DNA damage repair, cell survival, cell cycle control, differentiation, homocysteine/methionine/folate regulation, body temperature regulation, endocytosis, neuronal development, synaptic plasticity, etc. Abnormal expression and/or activity of some of these kinases, DYRK1A in particular, is seen in many human nervous system diseases, such as cognitive deficits associated with Down syndrome, Alzheimer’s disease and related diseases, tauopathies, dementia, Pick’s disease, Parkinson’s disease and other neurodegenerative diseases, Phelan-McDermid syndrome, autism, and CDKL5 deficiency disorder. DYRKs and CLKs are also involved in diabetes, abnormal folate/methionine metabolism, osteoarthritis, several solid cancers (glioblastoma, breast, and pancreatic cancers) and leukemias (acute lymphoblastic leukemia, acute megakaryoblastic leukemia), viral infections (influenza, HIV-1, HCMV, HCV, CMV, HPV), as well as infections caused by unicellular parasites (Leishmania, Trypanosoma, Plasmodium). This variety of pathological implications calls for (1) a better understanding of the regulations and substrates of DYRKs and CLKs and (2) the development of potent and selective inhibitors of these kinases and their evaluation as therapeutic drugs. This article briefly reviews the current knowledge about DYRK/CLK kinases and their implications in human disease.ViewShow abstractShow moreInsights into beta cell regeneration for diabetes via integration of molecular landscapes in human insulinomasArticleFull-text availableOct 2017Huan WangAaron BenderPeng WangAndrew F. StewartAlthough diabetes results in part from a deficiency of normal pancreatic beta cells, inducinghuman beta cells to regenerate is difficult. Reasoning that insulinomas hold the \"genomicrecipe” for beta cell expansion, we surveyed 38 human insulinomas to obtain insights intotherapeutic pathways for beta cell regeneration. An integrative analysis of whole-exome andRNA-sequencing data was employed to extensively characterize the genomic and molecularlandscape of insulinomas relative to normal beta cells. Here, we show at the pathway levelthat the majority of the insulinomas display mutations, copy number variants and/or dysregulationof epigenetic modifying genes, most prominently in the polycomb and trithoraxfamilies. Importantly, these processes are coupled to co-expression network modules associatedwith cell proliferation, revealing candidates for inducing beta cell regeneration. Validationof key computational predictions supports the concept that understanding themolecular complexity of insulinoma may be a valuable approach to diabetes drug discovery.ViewShow abstractBeta Cell Replacement in Mice Using Human Type 1 Diabetes Nuclear Transfer Embryonic Stem CellsArticleFull-text availableSep 2017DIABETESLina SuiNichole DanzlSean R. CampbellDieter EgliBeta cells derived from stem cells hold great promise for cell replacement therapy for diabetes. Here we examine the ability of nuclear transfer embryonic stem cells (NT-ES) derived from a type 1 diabetes patient to differentiate into beta cells, and provide a source of autologous islets for cell replacement. NT-ES cells differentiate in vitro with an average efficiency of 55% into C-peptide-positive cells, expressing markers of mature beta cells, including MAFA and NKX6.1. Upon transplantation in immunodeficient mice, grafted cells form vascularized islet-like structures containing MAFA/C-peptide-positive cells. These beta cells adapt insulin secretion to ambient metabolite status and show normal insulin processing. Importantly, NT-ES-beta cells maintain normal blood glucose levels after ablation of the mouse s endogenous beta cells. Cystic structures, but no teratomas, were observed in NT-ES-beta cell grafts. Isogenic induced pluripotent stem cell lines showed greater variability in beta cell differentiation. Even though different methods of somatic cell reprogramming result in stem cell lines that are molecularly indistinguishable, full differentiation competence is more common in ES cell lines than in iPS cell lines. These results demonstrate the suitability of NT-ES-beta for cell replacement for type 1 diabetes, and provide proof of principle for therapeutic cloning combined with cell therapy.ViewShow abstractDyrk1 inhibition improves Alzheimer s disease-like pathologyArticleFull-text availableAug 2017 Caterina Branca Darren M. Shaw Ramona Belfiore Salvatore OddoThere is an urgent need for the development of new therapeutic strategies for Alzheimer s disease (AD). The dual-specificity tyrosine phosphorylation-regulated kinase-1A (Dyrk1a) is a protein kinase that phosphorylates the amyloid precursor protein (APP) and tau and thus represents a link between two key proteins involved in AD pathogenesis. Furthermore, Dyrk1a is upregulated in postmortem human brains, and high levels of Dyrk1a are associated with mental retardation. Here, we sought to determine the effects of Dyrk1 inhibition on AD-like pathology developed by 3xTg-AD mice, a widely used animal model of AD. We dosed 10-month-old 3xTg-AD and nontransgenic (NonTg) mice with a Dyrk1 inhibitor (Dyrk1-inh) or vehicle for eight weeks. During the last three weeks of treatment, we tested the mice in a battery of behavioral tests. The brains were then analyzed for the pathological markers of AD. We found that chronic Dyrk1 inhibition reversed cognitive deficits in 3xTg-AD mice. These effects were associated with a reduction in amyloid-β (Aβ) and tau pathology. Mechanistically, Dyrk1 inhibition reduced APP and insoluble tau phosphorylation. The reduction in APP phosphorylation increased its turnover and decreased Aβ levels. These results suggest that targeting Dyrk1 could represent a new viable therapeutic approach for AD.ViewShow abstractSingle-Cell Mass Cytometry Analysis of the Human Endocrine PancreasArticleFull-text availableOct 2016 Julia Wang Maria L Golson Jonathan Schug Klaus H KaestnerThe human endocrine pancreas consists of multiple cell types and plays a critical role in glucose homeostasis. Here, we apply mass cytometry technology to measure all major islet hormones, proliferative markers, and readouts of signaling pathways involved in proliferation at single-cell resolution. Using this innovative technology, we simultaneously examined baseline proliferation levels of all endocrine cell types from birth through adulthood, as well as in response to the mitogen harmine. High-dimensional analysis of our marker protein expression revealed three major clusters of beta cells within individuals. Proliferating beta cells are confined to two of the clusters.ViewShow abstractGeneration of stem cell-derived β-cells from patients with type 1 diabetesArticleFull-text availableMay 2016Jeffrey R. MillmanChunhui XieAlana Van DervortDouglas A. MeltonWe recently reported the scalable in vitro production of functional stem cell-derived β-cells (SC-β cells). Here we extend this approach to generate the first SC-β cells from type 1 diabetic patients (T1D). β-cells are destroyed during T1D disease progression, making it difficult to extensively study them in the past. These T1D SC-β cells express β-cell markers, respond to glucose both in vitro and in vivo, prevent alloxan-induced diabetes in mice and respond to anti-diabetic drugs. Furthermore, we use an in vitro disease model to demonstrate the cells respond to different forms of β-cell stress. Using these assays, we find no major differences in T1D SC-β cells compared with SC-β cells derived from non-diabetic patients. These results show that T1D SC-β cells could potentially be used for the treatment of diabetes, drug screening and the study of β-cell biology.ViewShow abstractCC-401 Promotes β-Cell Replication via Pleiotropic Consequences of DYRK1A/B InhibitionArticleMar 2018Yassan Abdolazimi Sooyeon LeeHaixia XuJustin P AnnesPharmacologic expansion of endogenous β-cells is a promising therapeutic strategy for diabetes. To elucidate the molecular pathways that control β-cell growth we screened ∼2,400 bioactive compounds for rat β-cell replication-modulating activity. Numerous hit compounds impaired or promoted rat β-cell replication, including CC-401, an advanced clinical candidate previously characterized as a c-Jun N-terminal kinase (JNK) inhibitor. Surprisingly, CC-401 induced rodent (in vitro and in vivo) and human (in vitro) β-cell replication via dual specificity tyrosine-phosphorylation-regulated kinases (DYRK1A/B) inhibition. In contrast to rat β-cells, which were broadly growth responsive to compound treatment, human β-cell replication was only consistently induced by DYRK1A/B inhibitors. This effect was enhanced by simultaneous glycogen synthase kinase-3β (GSK-3β) or transforming growth factor-β (ALK5/TGF-β) inhibition. Prior work emphasized DYRK1A/B inhibition-dependent activation of nuclear factor of activated T-cells (NFAT) as the primary mechanism of human β-cell replication induction. However, inhibition of NFAT activity had limited impact on CC-401-induced β-cell replication. Consequently, we investigated additional effects of CC-401-dependent DYRK1A/B inhibition. Indeed, CC-401 inhibited DYRK1A-dependent phosphorylation/stabilization of the β-cell replication-inhibitor p27Kip1. Additionally, CC-401 increased expression of numerous replication-promoting genes normally suppressed by the dimerization partner, RB-like, E2F and multi-vulval class B (DREAM) complex, which depends upon DYRK1A/B activity for integrity, including MYBL2 and FOXM1. In summary, we present a compendium of compounds as a valuable resource for manipulating the signaling pathways that control β-cell replication and leverage a novel DYRK1A/B inhibitor (CC-401) to expand our understanding of the molecular pathways that control β-cell growth.ViewShow abstractCombinatorial Signal Perception in the BMP PathwayArticleSep 2017CELLYaron E. AntebiJames M. LintonHeidi Klumpe Michael ElowitzThe bone morphogenetic protein (BMP) signaling pathway comprises multiple ligands and receptors that interact promiscuously with one another and typically appear in combinations. This feature is often explained in terms of redundancy and regulatory flexibility, but it has remained unclear what signal-processing capabilities it provides. Here, we show that the BMP pathway processes multi-ligand inputs using a specific repertoire of computations, including ratiometric sensing, balance detection, and imbalance detection. These computations operate on the relative levels of different ligands and can arise directly from competitive receptor-ligand interactions. Furthermore, cells can select different computations to perform on the same ligand combination through expression of alternative sets of receptor variants. These results provide a direct signal-processing role for promiscuous receptor-ligand interactions and establish operational principles for quantitatively controlling cells with BMP ligands. Similar principles could apply to other promiscuous signaling pathways.ViewShow abstractAyahuasca Exposure: Descriptive Analysis of Calls to US Poison Control Centers from 2005 to 2015ArticleNov 2016C. William HeiseDaniel E BrooksBackground: Ayahuasca is a hallucinogenic plant preparation which usually contains the vine Banisteriopsis caapi and the shrub Psychotria viridis. This tea originates from the Amazon Basin where it is used in religious ceremonies. Because interest in these religious groups spreading as well as awareness of use of ayahuasca for therapeutic and recreational purposes, its use is increasing. Banisteriopsis caapi is rich in β-carbolines, especially harmine, tetrahydroharmine and harmaline, which have monoamine oxidase inhibiting (MAOI) activity. Psychotria viridis contains the 5HT2A/2C/1A receptor agonist hallucinogen N,N-dimethyltryptamine (DMT). Usual desired effects include hallucination, dissociation, mood alteration and perception change. Undesired findings previously reported are nausea, vomiting, hypertension, and tachycardia.Methods: All human exposure calls reported to the American Association of Poison Controls Centers (AAPCC) National Poison Data System (NPDS) between September 1, 2005 and September 1, 2015 were reviewed. Cases were filtered for specific plant derived ayahuasca-related product codes. Abstracted data included the following: case age and gender, exposure reason, exposure route, clinical manifestations, treatments given, medical outcomes and fatality.Results: Five hundred and thirty-eight exposures to ayahuasca botanical products were reported. The majority of the calls to poison control centers came from healthcare facilities (83%). The most common route of exposure was ingestion. Most cases were men (437, 81%, 95% CI 77.7% - 84.3%). The median age was 21 (IQR 18-29). Most exposures were acute. Three hundred thirty-seven (63%) were reported to have a major or moderate clinical effect. The most common clinical manifestations reported were hallucinations (35%), tachycardia (34%), agitation (34%), hypertension (16%), mydriasis (13%) and vomiting (6%). Benzodiazepines were commonly given (30%). There were 28 cases in the series who required endotracheal intubation (5%). Four cases were reported to have had a cardiac arrest and 7 a respiratory arrest. Twelve cases had a seizure. Reports of exposures called to poison centers appeared to increase during this period based on annual estimates. Three fatalities were reported.Conclusions: Ayahuasca use appears to be rising in the United States based on calls to poison control centers. While most use is reported to be safe and well tolerated, with possible beneficial effects, serious and life threatening adverse manifestations are possible. Most of the exposures reported to poison control centers were young people, more likely to be men and already in a healthcare facility. Further research, which includes comprehensive drug testing, will be needed to better identify the risks and effects of ayahuasca use.ViewShow abstractDevelopment of a reliable, automated screening system to identify small molecules and biologics that promote human β cell regenerationArticleSep 2016AM J PHYSIOL-ENDOC MKristie I. AamodtRadhika AramandlaJudy J. Brown Alvin PowersNumerous compounds stimulate rodent β cell proliferation; however, translating these findings to human β cells remains a challenge. To examine human β cell proliferation in response to such compounds, we developed a medium-throughput in vitro method of quantifying adult human β cell proliferation markers. This method is based on high-content imaging of dispersed islet cells seeded in 384-well plates and automated cell counting that identifies fluorescently-labeled β cells with high specificity using both nuclear and cytoplasmic markers. β cells from each donor were assessed for their function and ability to enter the cell cycle by co-transduction with adenoviruses encoding cell cycle regulators cdk6 and cyclin D3. Using this approach, we tested 12 previously identified mitogens including neurotransmitters, hormones, growth factors, and molecules involved in adenosine and Tgf-1β signaling. Each compound was tested in a wide concentration range either in the presence of basal (5 mM) or high (11 mM) glucose. Treatment with control compound harmine, a Dyrk1a inhibitor, led to a significant increase in Ki67+ β cells, while treatment with other compounds had limited to no effect on human β cell proliferation. This new, scalable approach reduces the time and effort required for sensitive and specific evaluation of human β cell proliferation, thus allowing for increased testing of candidate human β cell mitogens.ViewShow abstractThe Genetic Program of Pancreatic beta-Cell Replication In VivoArticleMar 2016DIABETES Agnes Klochendler Inbal CaspiNoa Corem Yuval DorThe molecular program underlying infrequent replication of pancreatic beta-cells remains largely inaccessible. Using transgenic mice expressing GFP in cycling cells we sorted live, replicating beta-cells and determined their transcriptome. Replicating beta-cells upregulate hundreds of proliferation-related genes, along with many novel putative cell cycle components. Strikingly, genes involved in beta-cell functions, namely glucose sensing and insulin secretion were repressed. Further studies using single molecule RNA in situ hybridization revealed that in fact, replicating beta-cells double the amount of RNA for most genes, but this upregulation excludes genes involved in beta-cell function. These data suggest that the quiescence-proliferation transition involves global amplification of gene expression, except for a subset of tissue-specific genes which are left behind and whose relative mRNA amount decreases. Our work provides a unique resource for the study of replicating beta-cells in-vivo.ViewShow abstractShow moreAdvertisementRecommended publicationsDiscover moreArticleFull-text availableSequential Activation of NFAT and c-Myc Transcription Factors Mediates the TGF- Switch from a Suppre...August 2010 · Journal of Biological Chemistry Garima Singh Shiv K SinghA König[...] Volker EllenriederTransforming growth factor beta (TGF-beta) has a dual role in carcinogenesis, acting as a growth inhibitor in early tumor stages and a promoter of cell proliferation in advanced diseases. Although this cellular phenomenon is well established, the underlying molecular mechanisms remain elusive. Here, we report that sequential induction of NFAT and c-Myc transcription factors is sufficient and ... [Show full abstract] required for the TGF-beta switch from a cell cycle inhibitor to a growth promoter pathway in cancer cells. Mechanistically, TGF-beta induces in a calcineurin-dependent manner the expression and activation of NFAT factors, which then translocate into the nucleus to promote c-Myc expression. In response to TGF-beta, activated NFAT factors bind to and displace Smad3 repressor complexes from the previously identified TGF-beta inhibitory element (TIE) to transactivate the c-Myc promoter. c-Myc in turn stimulates cell cycle progression and growth through up-regulation of D-type cyclins. Most importantly, NFAT knockdown not only prevents c-Myc activation and cell proliferation, but also partially restores TGF-beta-induced cell cycle arrest and growth suppression. Taken together, this study provides the first evidence for a Smad-independent master regulatory pathway in TGF-beta-promoted cell growth that is defined by sequential transcriptional activation of NFAT and c-Myc factors.View full-textArticleTurning it up a Notch: Cross-talk between TGFβ and Notch signalingMarch 2005 · BioEssays Michael KlüppelJeffrey L WranaSignaling through both the transforming growth factor beta (TGF beta) superfamily of growth factors and Notch play crucial roles during embryonic pattern formation and cell fate determination. Although both pathways are able to exert similar biological responses in certain cell types, a functional interaction between these two signaling pathways has not been described. Now, three papers provide ... [Show full abstract] evidence of both synergy and antagonism between TGF beta and Notch signaling. These reports describe a requirement for Notch signal transducers in TGF beta- and BMP-induced expression of Notch target genes, as well as in BMP-controlled cell differentiation and migration. These papers uncover a direct link between the Notch and TGF beta pathways and suggest a critical role for Notch in some of the biological responses to TGF beta family signaling.Read moreArticleSmads regulate collagen gel contraction by human dermal fibroblastsOctober 2003 · British Journal of DermatologyKoji SumiyoshiAtsuhito Nakao Yasuhiro Setoguchi[...]H OgawaTransforming growth factor (TGF)-beta induces fibroblast contraction that is implicated in efficient wound healing. The Smad family of proteins mediates signal transduction of the TGF-beta superfamily. However, its role in fibroblast contraction remains unclear.To determine whether Smad proteins regulate fibroblast contraction.We used an in vitro type I collagen gel contraction assay with human ... [Show full abstract] dermal fibroblasts infected with adenoviruses carrying Smads.Overexpression of Smad3, a major signal transducer in the Smad family, enhanced collagen gel contraction by fibroblasts when compared with fibroblasts overexpressing a control lacZ. Addition of a very low concentration of TGF-beta1 that did not affect the collagen gel contraction by itself enhanced the contraction by fibroblasts overexpressing Smad3. In contrast, TGF-beta1-mediated collagen gel contraction was suppressed by overexpression of Smad7, a major inhibitory regulator in the Smad family, in fibroblasts. In addition, inhibitors of the Erk and p38 pathways, PD98059 and SB203580, did not affect TGF-beta1-mediated collagen gel contraction by dermal fibroblasts.Modulation of Smad3 or Smad7 expression in dermal fibroblasts affected their contraction of collagen gels possibly by regulating TGF-beta signalling in fibroblasts.Read moreArticle[Expression characteristics of transforming growth factor-beta1 in human skin at different developme...April 2004 · Zhongguo wei zhong bing ji jiu yi xue = Chinese critical care medicine = Zhongguo weizhongbing jijiuyixueWei ChenXiao-Bing FuShi-Li Ge[...]Zhi-yong ShengTo investigate gene expression of transforming growth factor-beta(1) (TGF-beta(1)) and its two upstream signalling factors (smad2 and smad3) in fetal skin at different gestational ages and postnatal skin and its potential biological significance.Fetal skin samples of human embryo were obtained from spontaneous abortions at different gestational ages ranging from 13 to 32 weeks, and also skin ... [Show full abstract] collected from patients undergoing plastic surgery. After morphological characteristics of skin at different developmental stages were examined histologically, gene expressions of TGF-beta(1), smad2 and smad3 in skin specimens at different developmental stages were examined with reverse transcription-polymerase chain reaction analysis (RT-PCR).Gene expression of TGF-beta(1), smad2 and smad3 could all be detected in fetal skin and skin after birth. In skin from early gestational fetus, gene expressions of TGF-beta(1) and smad2 were weak. Along with advance in gestational age, gene expression of these two genes in skin became progressively stronger. In skin from late gestational fetus and skin after birth, the transcription contents of these two genes were significantly increased compared with early gestation fetus (P 0.05). On the contrary, gene expression of smad3 was apparently higher in younger fetal skin versus elder compared with that of late fetal skin (P 0.05). In skins after birth, the levels of smad3 gene expression were elevated to the level similar to that in early gestational fetal skin.The signal pathway mediated by TGF-beta(1) might be involved in regulating development of the skin at embryonic stage and in designating cetaceous structure and function, and also in wound healing after birth. The relative lack in expression of TGF-beta(1) and smad2 genes in skins from younger fetuses might contribute to fetal scar-less healing, in which the role of smad3 needs to be further investigated.Read moreDiscover the world s researchJoin ResearchGate to find the people and research you need to help your work.Join for free ResearchGate iOS AppGet it from the App Store now.InstallKeep up with your stats and moreAccess scientific knowledge from anywhere orDiscover by subject areaRecruit researchersJoin for freeLoginEmail Tip: Most researchers use their institutional email address as their ResearchGate loginPasswordForgot password? Keep me logged inLog inorContinue with GoogleWelcome back! Please log in.Email · HintTip: Most researchers use their institutional email address as their ResearchGate loginPasswordForgot password? Keep me logged inLog inorContinue with GoogleNo account? Sign upCompanyAbout usNewsCareersSupportHelp CenterBusiness solutionsAdvertisingRecruiting© 2008-2021 ResearchGate GmbH. All rights reserved.TermsPrivacyCopyrightImprint
Molecular Devices商品列表
| 图片/货号 | 产品名/品牌 | 价格/货期 | 操作 |
|---|

