100+universalprimersforsequencing.Freeforcustomersusing
MCLAB'ssequencingservices.
| | | | | | |
 | | | | | |
| DownloadFastaFile | | | | | |
IfyouareusingMCLAB'sDNAsequenceringservices,youdonotneedtopurchaseorsubmitanyprimerslistedhereinyourorders.YouonlyneedtospecifytheprimernamesinyourorderformandMCLABwilltakecareofeverythingrelatedtotheseprimers. WeprovidecustomoligonucleotidesynthesisserviceincombinationofourDNAsequencingservicetobetterassistourcustomers.Firsttimeprimersynthesisorderwillbefulfilledwithin24hours.Oncetheprimersaresynthesized,wealiquotthemfortheDNAsequencingandsavetherestintheMCEasyDepository™forpossIBLefutureusagefromourcustomers.Sothatthenexttimewhenyouorderthesequencingusingthesameprimers,youwillsavetimeandmoneybychoosingtheprimerswesavedforyouintheMCEasyDepository ™.Thisisacompletefreeservicefromustosaythanktoourcustomers.
WealsoprovideourcustomersfreetemplatesandprimersstorageinMCLAB'sfreezerarchivesforupto12monthsfromthetimeofsubmission.Thiswaywhenyouorderare-sequencingorsubmitothertemplatestobesequencedbythesamegroupofprimers,whatyouneedtodoisjusttelluswhichprimercombinationtouse.It'sjustlikethateasy. CustomerscouldalsogettheirDNAtemplatesand/orprimersbackbysimplyincludesuchinstructionsintheonlineorderformwhensubmittingtheirsequencingrequeststoMCLAB.It'slikethatsimple.
| # | Primer | Sequences(5'd~3') | Plasmid | Manufacturer | | 1 | 28glll | GTATGGGATTTTGCTAAACAAC | Ph.D.glll | NewEnglandBiolabs | | 1a | -96glll | CCCTCATAGTTAGCGTAACG | Ph.D.glll | NewEnglandBiolabs | | 2 | Ac5Forward | ACACAAAGCCGCTCCATCAG | pAc5.1/V5-His | Invitrogen | | 3 | ADReverse | AGATGGTGCACGATGCACAG | AD | | | 4 | a-Factor | TACTATTGCCAGCATTGCTGC | Pichia(pMET) | Invitrogen | | 5 | AOX1Forward | GACTGGTTCCAATTGACAAGC | Pichia | Invitrogen | | 6 | AOX1Reverse | GCAAATGGCATTCTGACATCC | Pichia | Invitrogen | | 7 | ASHSVTagPrimer | ATCCTCGGGGTCTTCCG | pIEx | Novagen | | 8 | ASSoTag18merPrimer | GTCCATGTGCTGGCGTTC | pIEx | Novagen | | 9 | AUG1Forward | CAATTTACATCTTTATTTATTAACG | Pichia | Invitrogen | | 10 | AUG1Reverse | GAAGAGAAAAACATTAGTTGGC | Pichia | Invitrogen | | 11 | BacForward | TTTTACTGTTTTCGTAACAGTTTT | pBlueBac4.5 | Invitrogen | | 12 | BacReverse | CGGATTTCCTTGAAGAGAGTA | pBlueBacHis2 | Invitrogen | | 13 | Baculovirus(+15)Reverse | ACTTCAAGGAGAATTTCC | pMelBac | Invitrogen | | 14 | BGHReverse | TAGAAGGCACAGTCGAGG | Universal | | | 15 | BKReverse | ACAGGAAACAGCTATGACCTTG | BKvirus | | | 16 | BKRSV | CGCCATTTGACCATTCA | pBK-rsv | | | 17 | BluescriptKS | TCGAGGTCGACGGTATC | pBluescript | Stratagene | | 18 | BluescriptSK | CGCTCTAGAACTAGTGGATC | pBluescript | Stratagene | | 19 | CBDcenA | TCAACGGCACCACCTGCA | | Novagen | | 20 | CBDcexLEAD | TAGGTGCAACTGTTGTTCTG | | Novagen | | 21 | CBDclos | CAACACCAGTTGTAAATCCA | | Novagen | | 22 | cIForward | GGATAGCGGTCAGGTGTT | pHybcI/HK | Invitrogen | | 23 | Citeprimer | GGGGACGTGGTTTTCCTTTG | pCITE | Novagen | | 24 | CMVForward | CGCAAATGGGCGGTAGGCGTG | Universal | | | 25 | CYC1Reverse | GCGTGAATGTAAGCGTGAC | Cyc1 | Invitrogen | | 26 | DsbA | CGAGTATGCTGATACAGTGA | DsRed | Clontech | | 27 | DsbC | GAATTTCTCGACGAACACCA | DsRed | Clontech | | 28 | DsRed1-C | AGCTGGACATCACCTCCCACAACG | DsRed | Clontech | | 29 | DsRed1-N | GTACTGGAACTGGGGGGACAG | DsRed | Clontech | | 30 | DsRed-C | AAGAAGCCTGTGCAGCTACCAGG | DsRed | Clontech | | 31 | DsRed-N | CGCCTTCTATTTCAAACTCGTGCC | DsRed | Clontech | | 32 | EBVReverse | GTGGTTTGTCCAAACTCATC | EBV | Invitrogen | | 33 | EF-1aForward | TCAAGCCTCAGACAGTGGTTC | | | | 34 | EGFP-C | CATGGTCCTGCTGGAGTTCGTG | EGFP | Clontech | | 35 | EGFP-N | CGTCGCCGTCCAGCTCGACCAG | EGFP | Clontech | | 36 | GAL1Forward | AATATACCTCTATACTTTAACGTC | Gal1 | Invitrogen | | 37 | Glprimer1 | TGTATCTTATGGTACTGTAACTG | | | | 38 | Glprimer2 | CTTTATGTTTTTGGCGTCTTCCA | | | | 39 | gp64promoter | CTACTAGTAAATCAGTCACACC | | | | 40 | gp64Signalprimer | GCGCTATTGTTTTATATGTGC | | | | 41 | IE1promoterprimer | TGGATATTGTTTCAGTTGCAAG | pIEx,pBIEx | Novagen | | 42 | Lamdagt10For | CTTTTGAGCAAGTTCAGGCCTGGTTAAG | LambdaGT10 | Promega | | 43 | Lamdagt10Rev | GAGGTGGCTTATGAGTATTTCTTCCAGG | LambdaGT10 | Promega | | 44 | Lamdagt11For | GGTGGCGACGACTCCTGGAGCCCG | LambdaGT11 | Promega | | 45 | Lamdagt11Rev | TTGACACCAGACCAACTGGTAATG | LambdaGT11 | Promega | | 46 | M13Forward(-20) | GTAAAACGACGGCCAG | Universal | | | 47 | M13Forward(-40) | GTTTTCCCAGTCACGAC | Universal | | | 47b | M13Reverse | CAGGAAACAGCTATGAC | Universal | | | 48 | pUCR/M13Forward | CCCAGTCACGACGTTGTAAAACG | pUC | PGEM-T PGEM- | | 49 | pUCR/M13Reverse | AGCGGATAACAATTTCACACAGGAA | pUC | PGEM-TPGEM- | | 50 | MTForward | CATCTCAGTGCAACTAAA | pMT/V5-His | Invitrogen | | 51 | myc-HisReverse | ATGACCGGTATGCATATTCAG | | | | 52 | OpIE2Forward | CGCAACGATCTGGTAAACAC | pMIB/V5-His | Invitrogen | | 53 | OpIE2Reverse | GACAATACAAACTAAGATTTAGTCAG | pMIB/V5-His | Invitrogen | | 54 | p10Forward | GTATATTAATTAAAATACTATACTG | pTriEx-2Hygro | Novagen | | 55 | pBADForward | ATGCCATAGCATTTTTATCC | E.coliaraBAD | Invitrogen | | 56 | pBADReverse | GATTTAATCTGTATCAGG | E.coliaraBAD | Invitrogen | | 57 | pCDM8Reverse | TAAGGTTCCTTCACAAAG | pCDM8 | Invitrogen | | 58 | pCEPForward | AGAGCTCGTTTAGTGAACCG | | | | 59 | pCMVForward | GATCCGGTACTAGAGGAACTGAAAAAC | | | | 60 | pDABForward | ATGCCATAGCATTTTTATCC | | Invitrogen | | 61 | pETUpstreamPrimer | ATGCGTCCGGCGTAGA(16) | | | | 62 | pETBlueDOWNPrimer | GTTAAATTGCTAACGCAGTCA | | | | 63 | pETBlueUPPrimer | TCACGACGTTGTAAAACGAC | | | | 64 | pFastBacForward | GGATTATTCATACCGTCCCA | pFastBac | Invitrogen | | 65 | pFastBacReverse | CAAATGTGGTATGGCTGATT | pFastBac | Invitrogen | | 66 | pGAPForward | GTCCCTATTTCAATCAATTGAA | pGAPz | Invitrogen | | 67 | pGENEForward | CTGCTATTCTGCTCAACCT | | | | 68 | pGEX3' | GAGCTGCATGTGTCAGAGG | Universal | | | 69 | pGEX5' | GGCAAGCCACGTTTGGTG | Universal | | | 70 | pHookForward | ACGGTGCATTGGAACGGAC | pHook-2,-3 | Invitrogen | | 71 | pHookReverse | GATTGCGTCGCATCGACCC | pHook-2,-3 | Invitrogen | | 72 | pHybLex/ZeoForward | AGGGCTGGCGGTTGGGGTTATTCGC | pHybLex/Zeo | Invitrogen | | 73 | pHybLex/ZeoReverse | GAGTCACTTTAAAATTTGTATACAC | pHybLex/Zeo | Invitrogen | | 74 | PinPointSequencingprimer | CGTGACGCGGTGGAGGGCG | PinPointXa-1,-2,-3,PinPointXa-1T-vector | Promega | | 75 | pJET1.2Forward | CGACTCACTATAGGGAGAGCGGC | | | | 76 | pJET1.2Reverse | AAGAACATCGATTTTCCATGGCAG | | | | 77 | pJG4-5Forward | GATGCCTCCTACCCTTATGATGTGCC | pJG4-5 | | | 78 | pJG4-5Reverse | GGAGACTTGACCAAACCTCTGGCG | pJG4-5 | | | 79 | PolyhedrinForward | AAATGATAACCATCTCGC | pVL1393 | Invitrogen | | 80 | PolyhedrinReverse | GTCCAAGTTTCCCTG(15) | pVL1393 | Invitrogen | | 81 | pQE-TriSystemForward | GTTATTGTGCTGTCTCATC | | | | 82 | pQE-TriSystemReverse | TCGATCTCAGTGGTATTTGTG | | | | 83 | pREPForward | GCTCGATACAATAAAGCCC | pREP4 | Invitrogen | | 84 | pRset | CTAGTTATTGCTCAGCGGTGG | pRset | Invitrogen | | 85 | pRHForward | CTGTCTCTATACTCCCCTATAG | pRH | Invitrogen | | 86 | pRHReverse | CAAAATTCAATAGTTACTATCGC | pRH | Invitrogen | | 87 | pRSETReverse | TAGTTATTGCTCAGCGGTGG | pRSET | Invitrogen | | 88 | pTargetSequencingPrimer | TTACGCCAAGTTATTTAGGTGACA | pTarget | Promega | | 89 | pTRCHisForward | GAGGTATATATTAATGTATCG | pTrcHis | Invitrogen | | 90 | pTrcHisReverse | GATTTAATCTGTATCAGG | pTrcHis | Invitrogen | | 91 | pTRE3' | CCACACCTCCCCCTGAAC | pTRE | BDBiosciences | | 92 | pTRE5' | CGCCTGGAGACGCCATCC | pTRE | | | 93 | pTriplEx3' | ACTCACTATAGGGCGAATTG | pTriplEx | Clontech | | 94 | pTriplEx5' | CTCGGGAAGCGCGCCATTGTGTTGGT | pTriplEx | Clontech | | 95 | pUniForward | CTATCAACAGGTTGAACTG | pUni | Invitrogen | | 96 | pUniReverse | CAGTCGAGGCTGATAGCGAGCT | pUni | Invitrogen | | 97 | pYESTrpForward | GATGTTAACGATACCAGCC | pYESTrp | Invitrogen | | 98 | pYESTrpReverse | GCGTGAATGTAAGCGTGAC | pYESTrp | Invitrogen | | 99 | QEPromoter | CCGAAAAGTGCCACCTG | pQE | Qiagen | | 100 | QEReverse | GTTCTGAGGTCATTACTGG | pQE | Qiagen | | 101 | R-20merPrimer | CAGCTATGACCATGATTACG | pSTBlue-1 | Novagen | | 102 | RsaAReverse | GCCGCGCCAGCGACGCGGAGGG | pCX | Invitrogen | | 103 | RVprimer3 | CTAGCAAAATAGGCTGTCCC | pGL/pCAT3 | Promega | | 104 | Rvprimer4 | GACGATAGTCATGCCCCGCG | pGL/pCAT3 | Promega | | 105 | SeqL-A(proximaltoattL1) | TCGCGTTAACGCTAGCATGGATCTC | pDONR201/pDONR207 | Invitrogen | | 106 | SeqL-B(proximaltoattL2) | GTAACATCAGAGATTTTGAGACAC | pDONR201/pDONR207 | Invitrogen | | 107 | STag18merPrimer | GAACGCCAGCACATGGAC | pIEx-1 | Novagen | | 108 | STagPrimer | CGAACGCCAGCACATGGACA | pIEx-1 | Novagen | | 109 | Sp6Promoter | GATTTAGGTGACACTATAG | Universal | | | 110 | SV40-pArev | CCTCTACAAATGTGGTATGG | pRL-SV40 | | | 111 | SV40-Promoter | GCCCCTAACTCCGCCCATCC | pRL-SV40 | | | 112 | T3Promoter | ATTAACCCTCACTAAAGGGA | Universal | | | 113 | T7EEV | ATGTCGTAATAACCCCGCCCCG | pAlterMAX,pSI,pCI,pCI-Neo,pCMVTnT,pTnT,phMGFPVector,HaloTagpHT2,psiCHECK-1,-2 | Promega | | 114 | T7gene10Primer | TGAGGTTGTAGAAGTTCCG | | | | 115 | T7Promoter | TAATACGACTCACTATAGGG | Universal | | | 116 | T7Reverse | TAGTTATTGCTCAGCGGTGG | Universal | | | 117 | T7Terminator | GCTAGTTATTGCTCAGCGG | Universal | | | 118 | U6Primer | GGGCAGGAAGAGGGCCTAT | | | | 119 | U-19merPrimer | GTTTTCCCAGTCACGACGT | M13mp18,pCITE | Novagen | | 121 | V5ReversePrimer | ACCGAGGAGAGGGTTAGGGAT | V5Epitope | Invitrogen | | 122 | VP22Forward | GGCCACGGCGACTCGA | | | | 123 | XpressForward | TATGGCTAGCATGACTGGT | XpressEpitope | Invitrogen | | 124 | VLH | TTGTGTGGAATTGTGAGCGG | | | | 125 | VF2 | TGCCACCTGACGTCTAAGAA | | | | 126 | VR | ATTACCGCCTTTGAGTGAGC | | | | 127 | TKpARev | CTTCCGTGTTTCAGTTAGC | | | | 128 | pQE60-FW | CCCGAAAAGTGCCACCTG | | | | 129 | pQE60-Rv | GTTCTGAGGTCATTACTGG | | | | 130 | SeqL-A(ATTL1) | GCGAGAGTAGGGAACTGC | pENTR | Invitrogen | | 131 | SeqL-B(ATTL2) | AACATCAGAGATTTTGAGACAC | pENTR | Invitrogen | | 132 | pmirGloF(7205bp) | GAGGTGCCTAAAGGACTGAC | pmirGlo | promega |
|
Molecular cloning and function analysis of PsMYB18 in 'Akihime' plum (Prunus salicina Lindl.)
FANG Zhizhen;JIANG Cuicui;ZHOU Danrong;PAN Shaolin;LIN Yanjuan;YE Xinfu;Fruit Research Institute,Fujian Academy of Agricultural Sciences/Fujian Engineering and Technology Research Center for Deciduous Fruit Trees,Fujian Academy of Agricultural Sciences;
【Objective】Temperature and light are important environmental factors that affect the biosynthesis and accumulation of anthocyanin in the fruit peel. Our previous study indicated that 20 ℃ temperature and light treatment(150 mol·m~(-2)·s~(-1)) could induce anthocyanin accumulation in the peel of postharvest'Akihime'plums. Comparative transcriptomic analysis results demonstrated that the expression of a R2 R3-MYB gene(designated as PsMYB18) was significantly upregulated in the fruit peel treated at20 ℃+ light. The objective of the study was to isolate and elucidate the function of PsMYB18 gene during anthocyanin accumulation in the peel of'Akihime'plum.【Methods】The total RNA of the plum fruit peels was extracted using EZNA Plant RNA Kit(Omega Bio-tek, USA) according to manufacturer's instructions. Real-time quantitative PCR(qRT-PCR) was employed to determine the expression of PsMYB18 in the peel of'Akihime'plum fruits treated at 20 ℃ + light, 20 ℃+ dark, 30 ℃+ light and30 ℃+ dark. First-strand cDNA was synthesized from 500 ng of total RNA using the PrimeScript RT reagent kit with gDNA Eraser(Takara, China). The qRT-PCR was performed using the Eppendorf Realplex4 real-time PCR system(Hamburg, Germany) in a total volume of 20 μL in each well containing 10μL of 2×SYBR~? Premix Ex Taq? II(Tli RNaseH Plus, TaKaRa), 1 μL of cDNA(in 1:10 dilution), and0.4 μL 10 μmol primers. The qPCR conditions were 30 s at 95 ℃, followed by 40 cycles of 5 s at 95 ℃,15 s at 60 ℃, and 30 s at 72 ℃, followed by 60 ℃ to 95 ℃ melting curve detection. Actin gene was used as the reference. For gene cloning, total RNA was extracted from the fruit peel treated with 20 ℃and light. The first-strand cDNA was synthesized using First Strand cDNA Synthesis Kit(Thermo Scientific, USA). PsMYB18 gene was isolated from the skin of'Akihime'plums by reverse transcription polymerase chain reaction(RT-PCR). Phylogenetic tree was constructed using the MEGA 5.02 software to investigate the evolution relationship between PsMYB18 and MYB proteins from other plant species.Multiple sequence alignments of PsMYB18 protein with MYB repressors from peach, apple, grape, poplar, Medicago truncatula, Fragaria × ananassa and Antirrhinum majus were performed using DNAMAN7.02. p CAMBIA1302 vector, which was linearized by restriction enzyme NcoI and BstEII was used to construct overexpression vectors. The coding regions of PsMYB18, PsMYB10.1 and PsbHLH3 were isolated using I-5? 2×High-Fidelity Master Mix(MCLAB, San Francisco, CA) and then cloned into the pCAMBIA1302 vector using One Step Seamless Cloning kit(Aidlab, China). All constructs were introduced into Agrobacterium tumefaciens GV3101. Tobacco(Nicotiana tabacum L.) leaf transient expression assay was performed to verify the function of PsMYB18 in anthocyanin biosynthesis. The Agrobacterium strain GV3101 containing overexpression vectors were grown at 28 ℃ in LB medium containing with antibiotics. Then Agrobacterium cells were harvested and resuspended in the infiltration buffer(10 mmol·L~(-1) MgCl2, 10 mmol·L~(-1) MES, pH 5.6, 100 μmol·L~(-1) acetosyringone) to a final OD600 of 0.8. The bacteria were incubated at room temperature for 3 h before infiltration. Digital photographs of anthocyanin development in tobacco leaves were taken at 7 days after infiltration.【Results】The qRTPCR analysis revealed that the expression of PsMYB18 in the fruit peel treated at 20 ℃ and light was significantly enhanced after 3 d of treatment and remained at a high level thereafter. However, no obvious expression upregulation of PsMYB18 was detected in the fruit peel treated at 20 ℃ + dark, 30 ℃ +light and 30 ℃ + dark. These results were consistent with RNA-seq data. The cDNA sequence of PsMYB18 was isolated from the peel of'Akihime'fruits treated at 20 ℃ and light. PsMYB18 contained open reading frame(ORF) of 702 bp in length, which was predicted to encode a protein of 539 amino acid residues. The results of phylogenetic analysis revealed that PsMYB18 and repressors of anthocyanin and proanthocyanidin biosynthesis, including FaMYB1, MtMYB2, PtMYB182, VvMYBC2-L3, VvMYBC2-L1 and PpMYB18, from other plants belonging to the same class. It had the closest relationship with PpMYB18 from peach. Multiple alignment of the deduced amino acid sequences of PsMYB18 and MYB repressors showed that PsMYB18 shared similarity of 96.57% with the PpMYB18 protein and contained the conserved R2 and R3 domains. It also had C1 and C2 repression motifs in the C-terminus. These results implicated that PsMYB18 could be a repressor of anthocyanin biosynthesis.To investigate the role of PsMYB18 in anthocyanin biosynthesis, the ORF of PsMYB18 was amplified and ligated into the pCAMBIA1302 vector. Transient color assays in tobacco leaves showed that coinfiltration of PsMYB18 with PsbHLH3 could not induce anthocyanin accumulation. Furthermore, coinfiltration of PsMYB10.1 with PsbHLH3 resulted in red pigmentation after 7 days, while no pigmentation was observed when PsMYB10.1 and PsbHLH3 were co-infiltrated with PsMYB18.【Conclusion】In this study, PsMYB18 was isolated and its expression was enhanced by the treatment at 20 ℃ and light. Phylogenetic and sequence analysis suggested that Pp MYB18 was likely a repressor of flavonoid biosynthesis. Transient color assay results showed that PsMYB18 was a negative regulator of anthocyanin biosynthesis.