AndrologyVolume 2, Issue 4 p. 521-530 Original Article Free Access Protamine mRNA ratio in stallion spermatozoa correlates with mare fecundity A. Paradowska-Dogan, Corresponding Author Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, Germany Correspondence: Agnieszka Paradowska-Dogan, Department of Urology, Pediatric Urology and Andrology, Section Molecular Andrology, Schubertstr. 81, 35392 Giessen, Germany. E-mail: Agnieszka.Paradowska@chiru.med.uni-giessen.deSearch for more papers by this authorA. Fernandez, Centre of Reproductive Medicine and Andrology, University Clinic Muenster, Muenster, GermanySearch for more papers by this authorM. Bergmann, Institute for Veterinary Anatomy, Histology and Embryology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorK. Kretzer, Institute for Veterinary Anatomy, Histology and Embryology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorC. Mallidis, Centre of Reproductive Medicine and Andrology, University Clinic Muenster, Muenster, GermanySearch for more papers by this authorM. Vieweg, Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorP. Waliszewski, Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorM. Zitzmann, Centre of Reproductive Medicine and Andrology, University Clinic Muenster, Muenster, GermanySearch for more papers by this authorW. Weidner, Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorK. Steger, Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorS. Kliesch, Centre of Reproductive Medicine and Andrology, University Clinic Muenster, Muenster, GermanySearch for more papers by this author A. Paradowska-Dogan, Corresponding Author Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, Germany Correspondence: Agnieszka Paradowska-Dogan, Department of Urology, Pediatric Urology and Andrology, Section Molecular Andrology, Schubertstr. 81, 35392 Giessen, Germany. E-mail: Agnieszka.Paradowska@chiru.med.uni-giessen.deSearch for more papers by this authorA. Fernandez, Centre of Reproductive Medicine and Andrology, University Clinic Muenster, Muenster, GermanySearch for more papers by this authorM. Bergmann, Institute for Veterinary Anatomy, Histology and Embryology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorK. Kretzer, Institute for Veterinary Anatomy, Histology and Embryology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorC. Mallidis, Centre of Reproductive Medicine and Andrology, University Clinic Muenster, Muenster, GermanySearch for more papers by this authorM. Vieweg, Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorP. Waliszewski, Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorM. Zitzmann, Centre of Reproductive Medicine and Andrology, University Clinic Muenster, Muenster, GermanySearch for more papers by this authorW. Weidner, Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorK. Steger, Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, GermanySearch for more papers by this authorS. Kliesch, Centre of Reproductive Medicine and Andrology, University Clinic Muenster, Muenster, GermanySearch for more papers by this author Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URLShare a linkShare onEmailFacebookTwitterLinked InRedditWechat Summary Highly compacted sperm DNA in protamine toroids and a minor fraction of nucleohistones are prerequisites for the efficient transmission of the paternal genome into the oocyte at fertilization. The objective of this study was to evaluate whether protamines might serve as a prognostic factor for stallion fertility. In situ hybridization detected specific expression of P1 mRNA in the cytoplasm of stage I to VII spermatids, whereas comparable immunohistochemical stainings showed that protein expression was delayed till elongating spermatids in differentiation stages III to VIII. No staining was detectable in cryptorchid testis because of the lack of spermatids in the seminiferous tubules. Using quantitative real-time polymerase chain reaction, we identified mRNA transcripts of P1 and 2 variants of protamine- 2 (P2, P3) in ejaculated spermatozoa from 45 thoroughbred stallions. According to the mare fertility descriptor (i.e. the ‘none-return-rate 28 percentage’ or NRR28%), stallions were divided into three groups (i.e. high, reduced and low fertility). The P2/P1 mRNA ratio was found to be significantly reduced in the group with lower fertility (p=0.016) and was slightly correlated with sperm concentration (correlation coefficient r=0.263). Furthermore, morphologically abnormal sperm count negatively correlated with P2/P1 mRNA ratio, indicating that spermatozoa carrying head defects display a diminished protamine ratio (r=−0.348). Conversely, the P2/P1 ratio was positively correlated with mare fertility or NRR28% (r=0.274). Interestingly, P3/P1 mRNA ratio remained unaltered in the investigated groups indicating that this variant plays a minor role in equine sperm chromatin compaction. Aberrant protamine transcripts content in equine spermatozoa was not associated with DNA defragmentation rate as measured by flow cytometric acridine orange test. On the basis of these results, we suggest that, similar to human, equine protamine expression constitutes a checkpoint of spermatogenesis and as a corollary the level of protamine mRNA may reflect the quality of spermatogenesis and spermatozoa\'s fertilizing capacity. Introduction Protamines are the sperm nuclear proteins which replace DNA-binding histones during late spermatogenesis. In contrast to histones, protamines are arginine-rich and positively charged, giving them an extreme affinity to the negatively charged DNA backbone. As a consequence, sperm chromatin is delivered to the zygote in a highly compacted and transcriptionally inactive form. Protamine-dependent packaging of paternal DNA within the spermatozoa and its subsequent deprotamination in the zygote represents a common feature of all mammalian species. While protamine-1 (P1) is present in all species analysed thus far and has been revealed to have high amino acid homology between bull (Mazrimas etal., 1986), boar (Tobita etal., 1983), mouse (Bellvé etal., 1988), stallion (Bélaïche etal., 1987) and man (Ammer etal., 1986), protamine-2 is absent or expressed in low levels in bull and boar (Coeling etal., 1972; Tobita etal., 1982). Interestingly, while the bull and boar possess genes for both forms, they specifically express P1 (Maier etal., 1990; Queralt etal., 1995), that said some evidence of protamine-2 mRNA has been reported in mature bull spermatozoa (Lalancette etal., 2008; Bissonnette etal., 2009; Ganguly etal., 2013). It is known that the protamine-1 to protamine-2 protein ratio varies between different mammalian species, but is constant within a specific species. Aberrant protamine ratios have been demonstrated to be related to male infertility (Corzett etal., 2002). These data are corroborated by functional studies in knockout mice, where it has been demonstrated that deletion of only one protamine allele – mimicking an aberrant protamine ratio – is sufficient to cause male infertility (Cho etal., 2001). In man, where most of the fertility-related protamine studies have been performed, subfertility has been correlated with either an abnormal persistence of histones (Silvestroni etal., 1976; Blanchard etal., 1990; Hofmann & Hilscher, 1991; Foresta etal., 1992; Zhang etal., 2006) or an aberrant protamine ratio (Balhorn etal., 1988; Belokopytova etal., 1993; De Yebra etal., 1998; Carrell & Liu, 2001; Mengual etal., 2003; Steger etal., 2003, 2008; Nasr-Esfahani etal., 2004; Aoki etal., 2005, 2006; De Mateo etal., 2007; Hammoud etal., 2009; Depa-Martynow etal., 2012; Rogenhofer etal., 2013). As the protamine ratio has been suggested a potential clinical parameter for the assessment of sperm fertilizing capacity, we wondered whether this is also applicable to the stallion. While in human spermatozoa, the relative proportion of protamine-1 to protamine-2 protein is regulated at approximately a 1:1 ratio (Balhorn etal., 1988), in stallion, the two variants of protamine-2 (P2 and P3) which have been found, constitute approximately 15% of the entire protamine content (Corzett etal., 2002). Furthermore, owing to similarities in protein length and amino acid composition, it has been suggested that these variants may be transcribed by homologous genes (Pirhonen etal., 1989). Similar to man, stallion fertility is gauged based upon the number, motility and morphology of spermatozoa(Jasko etal., 1992; Colenbrander etal., 2003) with the limit of normality being one billion morphologically normal and progressively motile spermatozoa per ejaculate (Kenney etal., 1983). The role of sperm motility in stallion fertility, however, remains controversial with claims ranging from no correlation (Voss etal., 1981; Dowsett & Pattie, 1982) to high correlation (Samper etal., 1991; Jasko etal., 1992). What is indisputable is that despite a sufficient number of progressively motile and morphologically normal spermatozoa, a high percentage of stallions are unable to achieve acceptable pregnancy rates. Consequently, there is a need for a suitable biomarker that reflects the sperm fertilizing potential and correlates with mare fecundity. This study, therefore, aims at investigating the expression pattern of protamine mRNA and protein during normal equine spermatogenesis and identifying any possible aberrations in subfertile stallions. Furthermore, we sought to identify any possible correlations between protamine mRNA ratio and semen parameters, DNA defragmentation rate and mare fecundity. The study was performed between March and September 2009 at the Northrhine-Westfalian (NRW) Landgestüt Warendorf, Germany, on 55 cross-bred stallions aged 3–18years. Ejaculates were obtained in presence of a mare using a phantom (Klug, 1990). Testes samples were collected by routine castration from a total of 34 horses, ranging in age from 1 to 27years. The castration was performed in the Clinic of Equine Surgery, Justus-Liebig University of Giessen. Specimen was fixed in Bouins solution, dehydrated and paraffin-embedded according to routine procedure. Sections (6μm) were stained with haematoxilin and eosin and analysed. Stages of spermatogenesis were defined according to Johnson etal. (1990). Directly after ejaculation, semen analysis was performed at the stallions′s test institution (Hengstprüfungsanstalt) of the NRW Landgestüt Warendorf, Germany. Sperm density was measured by a photometer (SpermaCue, Minitüb GmbH, Tiefenbach, Germany). Multiplication of sperm density with sperm volume resulted in total sperm count. Sperm motility was estimated using Nomarski technique (BX 60 by Olympus, Hamburg, Germany) and an object table (HAT 400 by Minitüb GmbH, Tiefenbach, Germany) heated to 38°C. Based on three different fields of vision, spermatozoa were assessed as progressive motile, local motile or immotile using magnification ×200. For the analysis of sperm morphology, 10μL ejaculate was streaked onto glass slides, air dried and stained according to the protocol of Papanicolaou. Subsequently, 2×200 sperm cells were assessed using magnification ×100 with sperm morphology being classified as normal (N), head defects (K), midpiece defects (M) and flagellum defects (S). Nicks between head and midpiece were classified as midpiece defects, nicks between midpiece and flagellum as flagellum defects. Separated sperm heads were classified as midpiece defects. Morphometric analyses were later performed on the same slides using the ISAS integrated semen analysis system version 1.0.19 (Proiser, Valencia, Spain) at the Centre of Reproductive Medicine and Andrology (CeRA), University Clinic Münster. The flow cytometric version of the acridine orange test (FCAOT) was performed on thawed cryopreserved samples at the Centre of Reproductive Medicine and Andrology (CeRA), University Clinic Münster as previously described (Evenson etal., 1999). Fluorescence data were acquired using a Cytomics FC 500 (Beckmann Coulter, Brea, CA, USA) from a total of 50000 spermatozoa per sample and collected using the CXP Cytometry List Mode Data Acquisition & Analysis Software CXP Cytometer 2.2. Results were expressed as DNA fragmentation index (DFI) (FCS Express V 3.0 Research Edition). In-situ hybridization was performed according to the protocol described by Steger etal. (1998) with several modifications. Based on sequence conservation of protamines in mammals, primers complementary to the human protamine-1 sequence were used to amplify the open reading frame of P1 from stallion testis complementary DNA (cDNA) (P1: forward primer: 5′-G CCAGGTACAGATGCTGTCGCAG-3′; reverse: 5′- TTAGTGTCTACATCTCGGTCTG-3′; P2: forward primer: 5′- GTGAGGAGCCTG AGCGAACGC-3′; reverse: 5′-TTAGTGCCTTCTGCATGTTCTCTTC-3′). After 40 cycles of PCR, the resulting product was electrophoresed on a 1% agarose gel, eluted using the Taq PCR-Core Kit and cloned into the pGEM-T Vector, according to the manufacturer\'s instructions (Promega, Heidelberg, Germany). After transformation of the E. coli XL1-Blue strain, mini preparations were performed (Qiagen, Hilden, Germany) and the plasmid clone DNA was sequenced at QIAGEN Genomic Services using SP6 and T7 primers. A DIG-labelled cRNA probe was produced using the previously described procedure (Steger etal., 1998; Hecht etal., 2009). Briefly, a 156 nt PCR product of stallion P1 was subcloned into pGEM-T (Promega), transformed into E. coli XL1-Blue strain (Stratagene, Heidelberg, Germany), cultured and then extracted by column purification (Qiagen). In vitro transcription of the DIG-labelled P1 was performed using the 10× RNA-DIG labelling mix (Roche, Mannheim, Germany) and RNA polymerases T3 and SP6. Vectors containing the protamine inserts were digested with NcoI and NotI (New England Biolabs, Frankfurt, Germany) for the production of sense and antisense cRNA respectively. Sections of testis from E. callabus were digested with proteinase K, post-fixed in 4% paraformaldehyde and incubated with the DIG-labelled sense or antisense cRNA probes (diluted 1:100 in hybridization buffer containing 50% deionized formamide, 10% dextran sulphate, 2× saline sodium citrate (SSC), 1× Denhardt\'s solution, 10mg/mL salmon sperm DNA and 10mg/mL yeast tRNA). Hybridization was performed overnight at 37°C in a humidified chamber containing 50% formamide in 2× SSC. Post-hybridization washes were performed, according to Lewis & Wells (1992). After blocking with 3% bovine serum albumin (BSA), sections were incubated with the anti-DIG Fab-antibody conjugated to alkaline phosphatase (Roche) overnight at 48°C. Staining was visualized by developing sections with nitroblue-tetrazolium/5-bromo-4-chloro-3-indolylphosphate in a humidified chamber protected from light. For each analysis, DIG-labelled cRNA sense probes were included as negative controls. Stage-specific analysis of equine spermatogenesis and protamine mRNA expression pattern was performed according to Johnson etal. (1990). For immunohistochemistry, 6μm sections were deparaffinized in xylene, hydrated through a graded series of ethanol, incubated in citrate buffer for 30min at 98°C then washed in 0.02m PBS, pH 7.4. To make the antibody accessible to protamine antigens, the highly compacted chromatin was treated with the ‘decondensing’ mix established by Van der Heijden etal., 2006 (i.e. freshly prepared 25mm dithiothreitol, 0.2% Triton X-100, 200IU heparin/mL in PBS) for 10min. Slides were then treated with 3% H2O2 in methanol for 30min followed by washing in PBS containing 1.5% BSA for 20min. Incubation followed with either monoclonal mouse anti-protamine-1 (Hub 1N; MAb-001) purchased from Briar Patch (Livermore, CA, USA) (dilution 1:1000 in DAKO Antibody Diluent) or anti-protamine-2 (Hub 2B; MAb-002, Briar Patch, dilution 1:200 in DAKO Diluent). The slides were incubated overnight in a humidified chamber at 4°C followed by application of DAKO EnVision System HRP (DAKO, Hamburg, Germany) for 30min at room temperature. Finally, immunodetection was performed using the DAB reagent. The ratio was determined at the Department of Urology, Paediatric Urology and Andrology, Justus Liebig University Giessen. Cryopreserved ejaculates were thawed and centrifuged for 10min at 1000g (4°C). The supernatant was removed, pellet was washed with 1mL PBS (pH 7.4) by centrifugation for 10min at 1000g (4°C) and resuspended in 250μL PBS. After mixing for 30sec with UltraTurrax, 1mL Trizol and 25μL 0.1m dithiothreithol (DTT) was added, the sample vortexed for 2min and centrifuged for 5min at 13000g (4°C). The supernatant was then transferred into a new tube, 300μL chloroform added, vortexed and incubated for 10min at room temperature. After a further centrifugation (20min at 13000g, 4°C), the upper phase was transferred into new tube, 10μL glycogen (2mg/mL), 0.1 Vol% NaAc (3m) and 1 Vol% isopropanol (−20°C) added, vortexed and incubated at −20°C overnight. The following day the sample was again centrifuged (20min at 13000g, 4°C), the supernatant discharged and the pellet dissolved in 10–15μL DEPC water. Digestion of DNA was then performed using RQ1 RNase-free DNase, according to the protocol of the manufacturer (Promega). First strand cDNA synthesis was carried out using iScript cDNA Kit (BioRad, Munich, Germany) and real-time quantitative PCR (qPCR) subsequently performed using SYBR Green Supermix, according to the protocol of the manufacturer (BioRad, Munich, Germany). Primer sequences used were as follows: P1 (GenBank Acc. No. NC009156) forward: 5′GGAGACGAAGATGTCGCAG; reverse: 5′ ACCTCAGGACAGTGTAGCGG 3′ (81bp product). P2: forward: 5′ ACCGCCGGGAGCTACTAC3′; reverse: 5′-GCCGTCTACGGAGCCTGT-3′ (73bp product). P3: forward 5′- TCCTCCATGAAGAAGCTGGT-3′; reverse: 5′- CTCCTCTTCCTCTGCCTCCT-3′ (93bp product). GAPDH (GenBank Acc. No. AF157626) forward: 5′ GACTCCACAACATATTCAGC 3′; reverse: 5′ GACTCCACAACATATTCAGC 3′ (77bp product). β-actin (GenBank Acc. No. AF035774) forward: 5′ ATCTGGGTCATCTTCTCG 3′; reverse: 5′ CACCACACCTTCTACAAC 3′ (107bp product). 18S rRNA (GenBank Acc. No. AJ311673) forward: 5′ GCTATC AATCTGTCAATCCTGTCC 3′; reverse: 5′ ATGCGGCGGCGTTATTCC 3′ (107bp product). Cycling conditions were as follows: 95°C for 3min; 40 cycles 95°C for 30sec, 60°C for 30sec, 72°C for 1min; 72°C for 3min. qPCR products were separated by capillary electrophoresis (Sensi Script Bio-Rad, Experion Munich, Germany) and analysed on a virtual gel (Experion, Bio-Rad, Germany). For the analysis of sequence homology of horse with human protamines, qPCR products were cloned and sequenced using standard Sanger protocols (SRD Biosciences, Bad Homburg, Germany). Sequence alignment was carried out using ClustalW 2.0.12 software (http://www.clustal.org/clustal2). Relative expression levels were expressed by ΔCt values which represent a measure of the log-ratio of the transcript abundances in the samples. The log-ratio of P2 and P1 is given by ΔCt=CtP2−CtP1 as described by Steger etal., 2008. To appraise the fertility of the stallions, data from the breeding registry of the NRW Landgestüt were obtained to determine the most often used measure of breeding success, the ‘non-return-rate 28’ (NNR28) percentage. This is defined as the percentage of mares which did not return within a period of 28days after artificial insemination (Van Buiten etal., 1999). Analysis of data was performed using either Microsoft Excel 2010, Statistica 8 (Statsoft, USA) or Sigma Plot 10 (Systat Software Inc., San Jose, CA, USA) according to the rules described elsewhere (Lewis, 1984). The null hypothesis was rejected at p 0.05. The normality of data distribution was evaluated by both the Shapiro–Wilk W test and the Kolmogorov–Smirnov one-sample test. If the hypothesis of normal distribution was rejected then the non-parametric Mann–Whitney U-test was applied and Spearman correlation coefficients for non-parametric variables were calculated. We assumed that r 0.2 denoted a meaningless correlation, whereas values greater that 0.2 constituted a correlation warranting further investigation. Based on the NRR28% (Van Buiten etal., 1999), stallions could be placed into one of three groups: low fertility (NRR28%=20–50%; n=14), reduced fertility (NRR28%=51–75%; n=27) and high fertility (NRR28%=76–100%, n=14). No difference was found in the ages of the stallions across the groups (average 8.05±4.8years), however, there were slight differences in sperm concentration (Table1). Unexpectedly the animals in the low fertility group had the highest concentration, those with reduced fertility the lowest whereas those with the highest NRR28% rating had sperm concentrations between the two other levels. Only the difference between concentrations between the low and reduced fertility groups reached statistical significance (p=0.022). However, the average of total sperm count was equal in all groups within the statistical error. Hence, the volume of ejaculates compensated the differences in sperm concentration. 336.14±123.20aa 1 vs. 2; p=0.022. 11.72±4464 33.11±7.31 33.11±7.341 Morphometric examination of stallion spermatozoa (Table2) showed that width, area and perimeter were similar across groups but found variations in the length of spermatozoa with those from the animals with low fertility (5.75±0.24μm) being statistically longer than both those with reduced (5.58±0.22μm, p=0.036) and high fertility (5.57±0.23μm; p=0.049). No significant difference (p=0.071) was found in sperm length between latter two groups. 2.91±1.31cc 2 vs. 3; p=0.034. 13.35±1.0 17.84±0.77 5.57±0.23bb 1 vs. 3; p=0.049. 3.00±1.30 13.70±0.91 17.73±0.67 No differences were found in sperm nDNA integrity regardless of fertility grouping as both the mean DFI and the percentage of spermatozoa with nDNA damage (i.e.% high DFI) were similar for all animals assessed (Table3). Expression pattern of protamine-1 mRNA in stallion\'s germ cells (in situ hybridization) mRNA expression of P1 was detectable in the cytoplasm of developing spermatids, appearing first during stage I of the spermatogenic cycle and being maintained during the different maturation events (Sa-Sd2) of spermatogenesis stages I-VII (Fig.1). No staining of elongating spermatids still embedded in the seminiferous tubule or elongated spermatids released into the lumen (stage VIII) was observed. Figure 1Open in figure viewerPowerPoint In situ hybridization indicating protamine-1 mRNA expression in horse testicular sections. P1 mRNA presence was found to be unique to spermatids specifically in their cytoplasm in stages I to VI. No staining of elongating spermatids in stage VII or elongated spermatids released into the lumen (stage VII) was observed. Scheme demonstrates stages of E. callabus spermatogenesis according to Johnson etal. (1990). A-spermatogonia type A; B-spermatogonia type B; pL-preleptotene spermatocytes; L-leptotene spermatocytes; P-pachytene spermatocytes; Z-zygotene spermatocytes; SII-spermatocytes II; Sa- round spermatids; Sb1-Sd2-spermatids in different maturation stages. Slides conterstained with haematoxilin. Primary magnification ×40. Immunohistochemical localization showed P1 protein to be present in the nuclei of elongating spermatids and spermatozoa from stage III to VIII (Fig.2). Beginning in spermatids of stages III and IV, P1 protein expression extended beyond the nucleus in stages V and VII where it was also found in the cytoplasm of elongating spermatids. During sperm release (stage VIII), P1 was found to be expressed in elongated spermatids and residual bodies, although the intensity of staining was diminished comparably to the earlier forms of these cells. This finding was probably as a result of high chromatin condensation and thus reduced access of the antibodies to the antigen. As P1 is highly specific for elongating spermatids and spermatozoa, it was not surprising that no immunohistochemical signal was detectable in testicular tissue missing these cell types. Specifically, in testicular samples from a horse with cryptorchidism, no staining was found because of the absence of spermatids in the seminiferous epithelium (Fig. S1). As no specific antibody for P2 is available the expression of this protein could not be assessed (Fig. S1). Figure 2Open in figure viewerPowerPoint Immunochistochemical localization of protamine-1 protein showing stage-specific expression during equine germ cell differentiation. Expression of protamine-1 was detected in the nucleus of elongating spermatids in stages III-VIII and in residual bodies (Rb) present in stage VII. No expression was detected in spermatids in stage I and II. A-spermatogonia type A; B-spermatogonia type B; pL-preleptotene spermatocytes; L-leptotene spermatocytes; P-pachytene spermatocytes; Z-zygotene spermatocytes; SII-spermatocytes II; Sa- round spermatids; Sb1-Sd2-spermatids in different maturation stages. Slides conterstained with haematoxilin. Primary magnification ×40. The time shift (i.e. 2 spermatogenic stages) between mRNA and protein expression was further corroborated by dual in situ hybridization and IHC data. P1 mRNA and protein were found to co-localize in spermatids from stages III to VI. Although P1 protein was detected in elongating spermatids and spermatozoa of stage VII and VIII, mRNA was not detected. The protamine-1/protamine-2 mRNA ratio from horse spermatozoa correlates with fertility parameters Using specific primer pairs aligned to horse genomic sequence (Fig.3) qPCR produced amplification products for P1 and two variants of P2 (P2 and P3) in samples from both testicular tissue and ejaculated spermatozoa. Both controls: negative for protamines (i.e. prostate tissue) and positive for intact mRNA (i.e. β-actin) produced the expected results. Figure 3Open in figure viewerPowerPoint qPCR products of stallion protamines separated by capillary electrophoresis. Lanes (L) 1–3: P1, P2 and P3 products from spermatozoa; L4: reference gene β-actin expression in spermatozoa. L5–8: P1-3 and β-actin in testis from fertile stallion. L 9–12: P 1-3 and β-actin in testis from subfertile stallion. L13–16: prostate samples where no products for P1-3 were detected (lanes 13–15) although β-actin is present (lane 16). L17–20: negative controls with primer dimers in lanes 17 and 19. The relative expression (Fig.4) of P1 ranged from −10.1 to 8.6, P2 from −2 to 5.6 and P3 from −7.8 to 4.6. In contrast to the expression levels of the two P2 variants which were similar across the groups, the P1 expression of the low and high fertility animals were found to be statistically different (p=0.019). As would be expected, this pattern was inversely reflected in the corresponding P2/P1 ratios. Namely, stallions with low fertility had the lowest P2/P1 ratio (1.5±4.5), those with reduced fertility had an increased level (3.7±4), whereas the high fertility group had a ratio (5.5±3.8) which was significantly higher (p=0.016) than the low fertility animals. Further analysis showed that the P2/P1 ratio was significantly, positively correlated with fertility rate (i.e. NRR28% – r=0.274; p 0.05; Fig.5C), sperm concentration (r=0.263; p 0.05; Fig.5A) and significantly negatively correlated with the percentage of morphologically aberrant spermatozoa (r=−0.348; p 0.05; Fig.5B). The percentage of spermatozoa with abnormal morphology was also found to be positively correlated with P1 expression (r=0.314; p 0.05). Figure 4Open in figure viewerPowerPoint Protamine mRNA ratios in ejaculates of stallions divided into three groups according to NRR28%. (A) P2/P1 mRNA ratio calculated as log-ratio of P2 and P1 (ΔCt=CtP2−CtP1). Asterisk indicates statistically significant difference between stallions with high and low fertility (p=0.019, non- parametric Mann–Whitney U-test) (B) P3 (P2-variant)/P1 mRNA ratio calculated as log-ratio of P3 and P1 (ΔCt=CtP3−CtP1) (C) P1 relative mRNA expression in stallion spermatozoa (high vs. low fertility p=0.05; non-parametric Mann–Whitney U-test). Figure 5Open in figure viewerPowerPoint Correlation of P2/P1 mRNA ratio (ΔCt=CtP2−CtP1) with: (A) Sperm density (r=0.263); (B) Morphological sperm defects (r=−0.348) and (C) Fertility defined as NRR28% (r=0.274). Based upon standard semen parameters and mare pregnancy rates, stallion fertility can be classified into one of three categories: fertile (80–90% pregnancy rates), subfertile ( 50% pregnancy rates) and sterile. During the reproductive season (March to September in the Northern Hemisphere), there is a concomitant increase in sperm count and quality leading to an expected conception rate of between 80 and 90% per insemination (Sutovsky, 2002). This is not always the case as reproductive efficiency, in horses as in most animals, can be affected by numerous extenuating factors such as age, heredity, level of veterinary management and disease. As such, and similar to humans, fertility disorders leading to subfertility or infertility are not uncommon in horses. Although sterility in stallions is mostly associated with age or age-related testicular degeneration (Turner etal., 2010; Mari etal., 2011), subfertility can result from a wide variety of known and as yet unidentified aetiologies. Andrological evaluations of fertility are primarily based upon the findings of traditional semen analysis, a series of assessments that provide information on the content of the ejaculate, the viability, movement and shape of spermatozoa and some insight into possible sperm function. Although informative, unless the abnormalities detected are extreme, the data obtained by these standard microscopic tests provides little indication of true fertility potential (Jequier, 2005) and as a consequence often leads to subfertile males (stallions and men alike) being erroneously assumed to have normal fertility. This observation is in line with the characteristic of stallion population presented in this study, where standard ejaculate parameters cannot be useful for distinguishing horses with higher or lower fertility. In veterinary medicine, the situation is further complicated in that some assessments available to humans are infrequently if ever performed on stallions. An example of one method rarely conducted is testicular biopsy for the assessment of spermatogenetic activity, a procedure that is avoided for fear that it harbours several risks (e.g. testicular haemorrhage, inflammation, swelling and as a consequence, a decline of spermatogenesis). Recent advances in our understanding of the molecular, genetic and epigenetic underpinnings of spermatogenesis and sperm function may provide potential solutions to this impasse by allowing the identification of objective molecular markers better able to predict fertility. To our knowledge, this is the first report demonstrating a stage-specific expression of both protamine mRNA and protein during equine spermatogenesis. Post-meiotic protamine mRNA expression and temporary delayed protein expression starting from elongating spermatids has been detected in mouse (Mali etal., 1988), cotton rat (Nanassy etal., 2010), marmoset (Hecht etal., 2009) and man (Steger etal., 1998). High evolutionary conservation of protamine mRNA and protein expression could be also confirmed in our study. By using the monoclonal antibody recognizing first six amino acids of amino terminal end of P1 which is present in variety of species (human, Rhesus monkey, boar, bull, dog, mule deer, ram, chinchilla, Rattus norvegicus, cotton rat, gerbil, mouse and Syrian hamster), we were able to detect specific signal for P1 also during stallion spermatogenesis. The lack of protamine staining in cryptorchid stallions exhibiting spermatogenic arrest confirms specific expression of protamines in spermatids and emphasizes its role for horse fertility (Fig.5). Regarding P2, minor data on the protein expression during horse spermatogenesis have been demonstrated. Applying IHC with antibodies that recognize the amino terminal segment of the fully processed P2 molecule, we failed to detect any specific staining on paraffin-fixed horse testicular sections. The possible explanation of our results could be either lack of fully processed P2 in horse spermatids, weak antibody affinity to stallions epitope or limited epitope accessibility in highly compacted chromatin. The regulation of protamine expression during spermatogenesis is coupled with histone to protamine exchange and represents a critical step for sperm chromatin condensation. The link between altered protamine expression and reduced spermatogenesis has often been a matter of debate (Carrell, 2010). As protamine genes are solely transcribed in round spermatids (Steger etal., 2000) and stored as silent mRNAs in elongated spermatids and spermatozoa (Steger etal., 2011), there is a link between mRNA levels in testicular spermatids and protein levels in ejaculated spermatozoa. In previous studies, we demonstrated aberrant protamine mRNA ratios in subfertile men applying in situ hybridization on testicular biopsies (Steger etal., 2001), real time quantitative PCR on testicular biopsies (Steger etal., 2003, 2008; ) and ejaculated spermatozoa (Steger etal., 2008; Rogenhofer etal., 2013). Reports from several studies also support the hypothesis that impaired protamine expression could be indicative of decreased or aberrant spermatogenesis. This study clearly suggests protamine-1 mRNA expression as a powerful candidate for the assessment of chromatin compaction in stallion\'s sperm nucleus. A reduced protamine (P2/P1) ratio was present in the group with lower fertility. A small decrease in the P2/P1 ratio could also be detected in the group with intermediate fertility, however, this difference was not statistically significant. Interestingly, the P2/P1 mRNA ratio might be a potential predictor of sperm concentration. The higher P2/P1 ratio, the higher sperm concentration and NRR28%. Owing to high variability of sperm concentration within investigated horse population, the importance of this correlation may have indicative value, however, the significance should be further tested with greater number of subjects. Morphologically aberrant sperm count negatively correlated with P2/P1 ratio indicating that spermatozoa carrying head defects display a diminished P2/P1 ratio. A positive correlation of the P2/P1 ratio with the NRR28% was identified in this study. The best mare fertility rate of 90–100% (NRR28%) was achieved when spermatozoa P2/P1 ratio was between 6 and 10. Although the mechanism of action is still not yet discovered, researcher speculate that either transcriptional/translational dysfunction or abnormal level of apoptosis in seminiferous tubules could be responsible for reduced spermatogenesis and sperm parameters. Haploinsufficiency of the protamines has been shown to cause altered spermatogenesis in mouse model. This defect was associated with lowered sperm counts and DNA damage (Cho etal., 2001, 2003). Described findings are in line with our study in stallions, where we demonstrate a negative correlation of the P2/P1 ratio with sperm concentration and a positive correlation with the percentage of morphologically aberrant spermatozoa. However, no changes in the DNA defragmentation rate from sperm DNA could be detected. Another study based on comparative analysis of DNA fragmentation rate in 11 different mammalian species, postulated that the presence of P2 in spermatozoa increases the in vitro DNA fragmentation rate (Gosálvez etal., 2011). Authors indicated significantly higher DNA instability after freezing and thawing in sperm chromatin of stallion and donkey, animals which possess both P1 and P2. Our study showed increased mRNA expression of P1 in stallions with lower fertility which rise the idea of better resistance against DNA fragmentation. As demonstrated by sperm chromatin dispersion (SCD) test, protamine expression significantly enhanced the probability of sperm DNA fragmentation. It has been postulated that the amount of cysteine residues in protamine 1 might be inevitable for sperm DNA stability (Gosálvez etal., 2011). Apparently, human spermatozoa from infertility patients exhibit remarkably higher DNA instability than fertile donors, a difference that could be indirectly associated with aberrant P1 and P2 ratio (Castillo etal., 2011; García-Peiró etal., 2011). Study of De Yebra etal. (1998) demonstrated reduction in P2 precursors spermatozoa of infertile men resulting in abnormal P1/P2 ratios and increased DNA damage (Cho etal., 2003; Nili etal., 2009; Simon etal., 2011). The inconsistence of the data regarding sperm defragmentation rate presented in the literature for both species, human and horse, might be also because of the selected technique for assessment of sperm defragmentation index. The evaluation of chromatin integrity comparing the sperm chromatin structure assay (SCSA), TdT-mediated-dUTP nick end labelling (TUNEL), the SCD test and acridine orange staining technique (AOT) highlighted the reproducibility of SCSA, TUNEL and SCD as predictive values for DNA fragmentation (Chohan etal., 2006). In contrast, AOT showed high variability and increased levels of DNA fragmentation as compared with other methods; therefore, the interpretation of AOT study might be in some cases questionable. We speculate that beside of methodological discrepancies, stereochemical phenomenon of protamine DNA interactions may provide possible explanation of why DFI did not correlate with mare fecundity and that protamine balance may be a critical mechanism for the production of fertility competent sperm chromatin. Although protamine mRNA ratio, similar to human spermatozoa, appears to be reliable predictor of sperm quality; nevertheless, stallion sperm chromatin structure deserves more intensive research to elucidate the pathogenesis of aberrant sperm compaction, as well as effects of aberrant protamine ratio and DNA fragmentation rate on early embryo development. This study was conducted in collaboration with the Northrhine Westfalian Landgestüt Warendorf, Germany. We greatly acknowledge the support by its director, Frau Susanne Schmidt-Rimkus, who gave freely access to all stallions, their semen samples and the data obtained by the institution and the breeding registry. This study was in part financed by a grant from the Centre of Reproductive Medicine and Andrology, University Clinic Münster (UKM), Germany and from the University Clinic of Giessen and Marburg (UKGM), Germany. We greatly acknowledge the support of the technical staff of both institutions. A.P-D., A.F., K.K., K.S., M.B. and S.K. were involved in the study concept and design. A.P-D. A. F., K.K., M.B., C.M. and M.V. contributed to data acquisition. M.Z. and P.W. performed statistical analysis. A.P-D., A. F., M.B., C.M., K.S., S.K. and W.W. were involved in analysis and interpretation of results. A.P., A.F., M.B., C.M. W.W., K.S. and S.K. contributed to drafting the manuscript. andr211-sup-0001-SupplementaryData.docxWord document, 1 MB Figure S1. Expression of protamine-1 in horse testicular sections showing specific staining of elongated spermatids during normal spermatogenesis A. (×40). B. (×63). C. Testicular section of stallion with cryptochorchism showing no specific staining for protamine-1 because of lack of spermatids and spermatozoa (×40). D. Negative control without primary antibodies (×63). Please note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article. Ammer H, Henschen A & Lee CH. (1986) Isolation and amino-acid sequence analysis of human sperm protamines P1 and P2. Occurrence of two forms of protamine P2. Biol Chem Hoppe Seyler 367, 515– 522. Aoki VW, Moskovtsev SI, Willis J, Liu L, Mullen JB & Carrell DT. (2005) DNA integrity is compromised in protamine-deficient human sperm. J Androl 26, 741– 748. Wiley Online Library Aoki VW, Emery BR, Liu L & Carrell DT. (2006) Protamine levels vary between individual sperm cells of infertile human males and correlate with viability and DNA integrity. J Androl 27, 890– 898. Wiley Online Library Balhorn R, Reed S & Tanphaichitr N. (1988) Aberrant protamine 2 ratios in sperm of infertile human males. Experientia 44, 52– 55. Bélaïche D, Loir M, Kruggle W & Sautière P. (1987) Isolation and characterization of two protamines St1 and St2 from stallion spermatozoa, and amino-acid sequence of the major protamine St1. Biochim Biophys Acta 913, 145– 149. Bellvé AR, McKay DJ, Renaux BS & Dixon GH. (1988) Purification and characterization of mouse protamines P1 and P2. Amino acid sequence of P2. Biochemistry 27, 2890– 2897. Belokopytova IA, Kostyleva EI, Tomilin AN & Vorob\'ev VI. (1993) Human male infertility may be due to a decrease of the protamine P2 content in sperm chromatin. Mol Reprod Dev 34, 53– 57. Wiley Online Library Bissonnette N, Lévesque-Sergerie JP, Thibault C & Boissonneault G. (2009) Spermatozoal transcriptome profiling for bull sperm motility: a potential tool to evaluate semen quality. Reproduction 138, 65– 80. Blanchard Y, Lescoat D & Le Lannou D. (1990) Anomalous distribution of nuclear basic proteins in round-headed human spermatozoa. Andrologia 22, 549– 555. Wiley Online Library Carrell DT. (2010) Biology of spermatogenesis and male infertility. Syst Biol Reprod Med 56, 205– 206. Carrell DT & Liu L. (2001) Altered protamine 2 expression is uncommon in donors of known fertility, but common among men with poor fertilizing capacity, and may reflect other abnormalities of spermiogenesis. J Androl 22, 604– 610. Wiley Online Library Castillo J, Simon L, de Mateo S, Lewis S & Oliva R. (2011) Protamine/DNA ratios and DNA damage in native and density gradient centrifuged sperm from infertile patients. J Androl 32, 324– 332. Wiley Online Library Cho C, Willis WD, Goulding EH, Jung-Ha H, Choi YC, Hecht NB etal. (2001) Haploinsufficiency of protamine-1 or -2 causes infertility in mice. Nat Genet 28, 82– 86. Cho C, Jung-Ha H, Willis WD, Goulding EH, Stein P, Xu Z etal. (2003) Protamine 2 deficiency leads to sperm DNA damage and embryo death in mice. Biol Reprod 69, 211– 217. Chohan KR, Griffin JT, Lafromboise M, De Jonge CJ & Carrell DT. (2006) Comparison of chromatin assays for DNA fragmentation evaluation in human sperm. J Androl 27, 53– 59. Wiley Online Library Coeling JP, Monfoort CH, Rozijn TH, Geuvers-Leuven JA, Schiphof R, Steyn- Parvé EP etal. (1972) Isolation and partial characterization of a basic protein from bovine sperm heads. Biochim Biophys Acta 285, 1– 14. Colenbrander B, Gadella BM & Stout TAE. (2003) The predictive value of semen analysis in the evaluation of stallion fertility. Reprod Domest Anim 38, 305– 311. Wiley Online Library Corzett M, Mazrimas J & Balhorn R. (2002) Protamine 1: protamine 2 stoichiometry in the sperm of eutherian mammals. Mol Reprod Dev 61, 519– 527. Wiley Online Library De Mateo S, Martínez-Heredia J, Estanyol JM, Domínguez-Fandos D, Vidal-Taboada JM, Ballescà JL etal. (2007) Marked correlations in protein expression identified by proteomic analysis of human spermatozoa. Proteomics 7, 4264– 4277. Wiley Online Library De Yebra L, Ballesca JL, Vanrell JA, Corzett M, Balhorn R & Oliva R. (1998) Detection of P2 precursors in the sperm cells of infertile patients who have reduced protamine P2 levels. Fert Steril 69, 755– 759. Depa-Martynow M, Kempisty B, Jagodziński PP, Pawelczyk L & Jedrzejczak P. (2012) Impact of protamine transcripts and their proteins on the quality and fertilization ability of sperm and the development of preimplantation embryos. Reprod Biol 12, 57– 72. Dowsett KF & Pattie WA. (1982) Characteristics and fertility of stallion semen. J Reprod Fertil Suppl 32, 1– 8. Evenson DP, Jost LK, Marshall D, Zinaman MJ, Clegg E, Purvis K etal. (1999) Utility of the sperm chromatin structure assay as a diagnostic and prognostic tool in the human fertility clinic. Hum Reprod 14, 1039– 1049. Foresta C, Zorzi M, Rossato M & Varotto A. (1992) Sperm nuclear instability and staining with aniline blue: abnormal persistence of histones in spermatozoa in infertile men. Int J Androl 15, 330– 337. Wiley Online Library Ganguly I, Gaur GK, Kumar S, Mandal DK, Kumar M, Singh U etal. (2013) Differential expression of protamine 1 and 2 genes in mature spermatozoa of normal and motility impaired semen producing crossbred Frieswal (HF×Sahiwal) bulls. Res Vet Sci 94, 256– 262. García-Peiró A, Martínez-Heredia J, Oliver-Bonet M, Abad C, Amengual MJ, Navarro J etal. (2011) Protamine 1 to protamine 2 ratio correlates with dynamic aspects of DNA fragmentation in human sperm. Fertil Steril 95, 105– 109. Gosálvez J, López-Fernández C, Fernández JL, Gouraud A & Holt WV. (2011) Relationships between the dynamics of iatrogenic DNA damage and genomic design in mammalian spermatozoa from eleven species. Mol Reprod Dev 78, 951– 961. Wiley Online Library Hammoud SS, Nix DA, Zhang H, Purwar J, Carrell DT & Cairns BR. (2009) Distinctive chromatin in human sperm packages genes for embryo development. Nature 460, 473– 478. Hecht N, Behr R, Hild A, Bergmann M, Weidner W & Steger K. (2009) The common marmoset (Callithrix jacchus) as a model for histone and protamine expression during human spermatogenesis. Hum Reprod 24, 536– 545. Hofmann N & Hilscher B. (1991) Use of aniline blue to assess chromatin condensation in morphologically normal spermatozoa in normal and infertile men. Hum Reprod 6, 979– 982. Jasko DJ, Little TV, Lein DH & Foote RH. (1992) Comparison of spermatozoal movement and semen characteristics with fertility in stallions: 64 cases (1987–1988). J Am Vet Med Assoc 200, 979– 985. Jequier AM. (2005) Is quality assurance in semen analysis still really necessary? A clinician\'s viewpoint. Hum Reprod 20, 2039– 2042. Johnson L, Hardy VB & Martin MT. (1990) Staging equine seminiferous tubules by Nomarski optics in unstained histologic sections and in tubules mounted in toto to reveal the spermatogenic wave. Anat Rec 227, 167– 174. Wiley Online Library Kenney RM, Hurtgen JP, Pierson RH, Witherspoon D & Simons J. (1983). Clinical fertility evaluation of the stallion. J Soc Theriogenol 9, 7– 62. Klug E. (1990) Frischsamenübertragung beim Pferd. 3. Aufl., Verlag M. & H. Schaper, Hannover, 23, 118. Lalancette C, Thibault C, Bachand I, Caron N & Bissonnette N. (2008) Transcriptome analysis of bull semen with extreme nonreturn rate: use of suppression-subtractive hybridization to identify functional markers for fertility. Biol Reprod 78, 618– 635. Lewis FA & Wells M. (1992) Detection of virus in infected human tissue by in-situ hybridization. In: In-situ Hybridization, A Practical Approach (ed. DG Wilkinson), pp. 121– 135. Oxford University Press, Oxford. Maier WM, Nussbaum G, Domenjoud L, Klemm U & Engel W. (1990) The lack of protamine 2 (P2) in boar and bull spermatozoa is due to mutations within the P2 gene. Nucleic Acids Res 18, 1249– 1254. Mali P, Sandberg M, Vuorio E, Yelick PC, Hecht NB & Parvinen M. (1988) Localization of protamine 1 mRNA in different stages of the cycle of the rat seminiferous epithelium. J Cell Biol 107, 407– 412. Mari G, Castagnetti C, Rizzato G, Mislei B, Iacono E & Merlo B. (2011) Density gradient centrifugation of sperm from a subfertile stallion and effect of seminal plasma addition on fertility. Anim Reprod Sci 126, 96– 100. Mazrimas JA, Corzett M, Campos C & Balhorn R. (1986) A corrected primary sequence for bull protamine. Biochim Biophys Acta 872, 11– 15. Mengual L, Ballescá JL, Ascaso C & Oliva R. (2003) Marked Differences in Protamine Content and P1/P2 Ratios. J Androl 24, 438– 447. Wiley Online Library Nanassy L, Griffin J, Emery BR & Carrell DT. (2010) The marmoset and cotton rat as animal models for the study of sperm chromatin packaging. Syst Biol Reprod Med 56, 207– 212. Nasr-Esfahani MH, Razavi S, Mozdarani H, Mardani M & Azvagi H. (2004) Relationship between protamine deficiency with fertilization rate and incidence of sperm premature chromosomal condensation post-ICSI. Andrologia 36, 95– 100. Wiley Online Library Nili HA, Mozdarani H & Aleyasin A. (2009) Correlation of sperm DNA damage with protamine deficiency in Iranian subfertile men. Reprod Biomed Online 18, 479– 485. Pirhonen A, Linnala-Kankkunen A & Mäenpää PH. (1989) Comparison of partial amino acid sequences of two protamine 2 variants from stallion sperm. Structural evidence that the variants are products of different genes. FEBS Lett 244, 199– 202. Wiley Online Library Queralt R, Adroer R, Oliva R, Winkfein RJ, Retief JD & Dixon GH. (1995) Evolution of protamine P1 genes in mammals. J Mol Evol 40, 601– 607. Rogenhofer N, Dansranjavin T, Schorsch M, Spiess A, Wang H, Von Schönfeldt V etal. (2013) The sperm protamine mRNA ratio as a clinical parameter to estimate the fertilizing potential of men taking part in an ART programme. Hum Reprod 28, 969– 978. Samper JC, Hellander JC & Crabo BG. (1991) Relationship between the fertility of fresh and frozen stallion semen and semen quality. J Reprod Fertil Suppl 44, 107– 114. Silvestroni L, Frajese G & Fabrizio M. (1976) Histones instead of protamines in terminal germ cells of infertile, oligospermic men. Fertil Steril 27, 1428– 1437. Simon L, Castillo J, Oliva R & Lewis SEM. (2011) Relationships between human sperm protamines, DNA damage and assisted reproduction outcomes. Reprod Biomed Online 23, 724– 734. Steger K, Klonisch T, Gavenis K, Drabent B, Doenecke D & Bergmann M. (1998) Expression of mRNA and protein of nucleoproteins during human spermiogenesis. Mol Hum Reprod 4, 939– 945. Steger K, Pauls K, Klonisch T, Franke FE & Bergmann M. (2000) Expression of protamine-1 and -2 mRNA during human spermiogenesis. Mol Hum Reprod 6, 219– 225. Steger K, Failing K, Klonisch T, Behre HM, Manning M, Weidner W etal. (2001) Round spermatids from infertile men exhibit decreased protamine-1 and -2 mRNA. Hum Reprod 16, 709– 716. Steger K, Fink L, Failing K, Bohle RM, Kliesch S, Weidner W etal. (2003) Decreased protamine-1 transcript levels in testes from infertile men. Mol Hum Reprod 9, 331– 336. Steger K, Wilhelm J, Konrad L, Stalf T, Greb R, Diemer T etal. (2008) Both protamine-1 to protamine-2 mRNA ratio and Bcl2 mRNA content in testicular spermatids and ejaculated spermatozoa discriminate between fertile and infertile men. Hum Reprod 23, 11– 16. Steger K, Cavalcanti MCO & Schuppe HC. (2011) Prognostic markers for competent human spermatozoa: fertilizing capacity and contribution to the embryo. Int J Androl 34, 513– 527. Wiley Online Library Sutovsky P. (2002) Differential ubiquitination of stallion sperm proteins: possible implications for infertility and reproductive seasonality. Biol Reprod 68, 688– 698. Tobita T, Nomoto M, Nakano M & Ando T. (1982) Isolation and characterization of nuclear basic protein (protamine) from boar spermatozoa. Biochim Biophys Acta 707, 252– 258. Tobita T, Tsutsummi H, Kato A, Susuke H, Nomoto M, Nakano M etal. (1983) Complete amino acid sequence of boar protamine. Biochim Biophys Acta 744, 141– 146. Turner RM, Rathi R, Honaramooz A, Zeng W & Dobrinski I. (2010) Xenografting restores spermatogenesis to cryptorchid testicular tissue but does not rescue the phenotype of idiopathic testicular degen- eration in the horse (Equus caballus). Reprod Fertil Dev 22, 673– 683. Van Buiten A, van den Broek J, Schukkena YH & Colenbrandera B. (1999) Validation of non-return rate as a parameter for stallion fertility. Livest Prod Sci 60, 13– 19. Van der Heijden GW, Derijck H, Ramos L, Giele M, van der Vlag J & de Boer P. (2006) Transmission of modified nucleosomes from the mouse male germline to the zygote and subsequent remodeling of paternal chromatin. Dev Biol 298, 458– 469. Voss JL, Pickett BW & Squires EL. (1981) Stallion spermatozoal morphology and motility and their relationships to fertility. J Am Vet Med Assoc 178, 287– 289. Zhang X, San Gabriel M & Zini A. (2006) Sperm nuclear histone to protamine ratio in fertile and infertile men: evidence of heterogeneous subpopulations of spermatozoa in the ejaculate. J Androl 27, 414– 420. Wiley Online Library The full text of this article hosted at iucr.org is unavailable due to technical difficulties. Please check your email for instructions on resetting your password. If you do not receive an email within 10 minutes, your email address may not be registered, and you may need to create a new Wiley Online Library account. Can\'t sign in? Forgot your username? Enter your email address below and we will send you your username If the address matches an existing account you will receive an email with instructions to retrieve your username

>>> 更多资讯详情请访问蚂蚁淘商城