Description | Mouse Sequence CpG ODN (1826) Type B: 5" T*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T 3" (* Indicates a phosphorothioate modification) Negative Control oligo: 5" TCCATGAGCTTCCTGAGCTT 3" Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml. |
Specificity | CpG ODN Type B (1826) |
Dilutions |
| |
Application Notes | A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation. | |
Publications |
|